ID: 999389611

View in Genome Browser
Species Human (GRCh38)
Location 5:151180613-151180635
Sequence CTGTGGCCAGGGAGGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999389611_999389626 26 Left 999389611 5:151180613-151180635 CCTAGCTCCCTCCCTGGCCACAG No data
Right 999389626 5:151180662-151180684 AATCAGGGGTAGGTACCTGTGGG No data
999389611_999389623 12 Left 999389611 5:151180613-151180635 CCTAGCTCCCTCCCTGGCCACAG No data
Right 999389623 5:151180648-151180670 GGAGCAATAGGCAGAATCAGGGG No data
999389611_999389621 10 Left 999389611 5:151180613-151180635 CCTAGCTCCCTCCCTGGCCACAG No data
Right 999389621 5:151180646-151180668 GTGGAGCAATAGGCAGAATCAGG No data
999389611_999389620 0 Left 999389611 5:151180613-151180635 CCTAGCTCCCTCCCTGGCCACAG No data
Right 999389620 5:151180636-151180658 GCATCTGGATGTGGAGCAATAGG No data
999389611_999389624 16 Left 999389611 5:151180613-151180635 CCTAGCTCCCTCCCTGGCCACAG No data
Right 999389624 5:151180652-151180674 CAATAGGCAGAATCAGGGGTAGG No data
999389611_999389625 25 Left 999389611 5:151180613-151180635 CCTAGCTCCCTCCCTGGCCACAG No data
Right 999389625 5:151180661-151180683 GAATCAGGGGTAGGTACCTGTGG No data
999389611_999389618 -9 Left 999389611 5:151180613-151180635 CCTAGCTCCCTCCCTGGCCACAG No data
Right 999389618 5:151180627-151180649 TGGCCACAGGCATCTGGATGTGG No data
999389611_999389622 11 Left 999389611 5:151180613-151180635 CCTAGCTCCCTCCCTGGCCACAG No data
Right 999389622 5:151180647-151180669 TGGAGCAATAGGCAGAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999389611 Original CRISPR CTGTGGCCAGGGAGGGAGCT AGG (reversed) Intergenic
No off target data available for this crispr