ID: 999394112

View in Genome Browser
Species Human (GRCh38)
Location 5:151215636-151215658
Sequence GTTCTTCAGCAGACAGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999394106_999394112 -6 Left 999394106 5:151215619-151215641 CCTCCACACCATCCCCTGTTCTT 0: 1
1: 0
2: 6
3: 58
4: 572
Right 999394112 5:151215636-151215658 GTTCTTCAGCAGACAGTGTAAGG 0: 1
1: 0
2: 0
3: 11
4: 154
999394100_999394112 29 Left 999394100 5:151215584-151215606 CCCTTGCTCAGGAGGCCTGGGTG 0: 1
1: 0
2: 1
3: 35
4: 308
Right 999394112 5:151215636-151215658 GTTCTTCAGCAGACAGTGTAAGG 0: 1
1: 0
2: 0
3: 11
4: 154
999394103_999394112 14 Left 999394103 5:151215599-151215621 CCTGGGTGAGAACCTGGAGCCCT 0: 1
1: 0
2: 2
3: 27
4: 285
Right 999394112 5:151215636-151215658 GTTCTTCAGCAGACAGTGTAAGG 0: 1
1: 0
2: 0
3: 11
4: 154
999394105_999394112 -5 Left 999394105 5:151215618-151215640 CCCTCCACACCATCCCCTGTTCT 0: 1
1: 0
2: 3
3: 85
4: 514
Right 999394112 5:151215636-151215658 GTTCTTCAGCAGACAGTGTAAGG 0: 1
1: 0
2: 0
3: 11
4: 154
999394101_999394112 28 Left 999394101 5:151215585-151215607 CCTTGCTCAGGAGGCCTGGGTGA 0: 1
1: 0
2: 2
3: 44
4: 268
Right 999394112 5:151215636-151215658 GTTCTTCAGCAGACAGTGTAAGG 0: 1
1: 0
2: 0
3: 11
4: 154
999394104_999394112 2 Left 999394104 5:151215611-151215633 CCTGGAGCCCTCCACACCATCCC 0: 1
1: 0
2: 1
3: 40
4: 365
Right 999394112 5:151215636-151215658 GTTCTTCAGCAGACAGTGTAAGG 0: 1
1: 0
2: 0
3: 11
4: 154
999394107_999394112 -9 Left 999394107 5:151215622-151215644 CCACACCATCCCCTGTTCTTCAG 0: 1
1: 0
2: 1
3: 42
4: 358
Right 999394112 5:151215636-151215658 GTTCTTCAGCAGACAGTGTAAGG 0: 1
1: 0
2: 0
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999394112 Original CRISPR GTTCTTCAGCAGACAGTGTA AGG Intronic
902465837 1:16618040-16618062 TTTCTTCAGCAAACAGTAAAAGG - Intergenic
903403316 1:23074658-23074680 GTTCTCCTGCAGAAATTGTATGG + Intronic
904708667 1:32411850-32411872 GGGCTTCAGCAGTCAGAGTATGG - Intergenic
907577718 1:55542692-55542714 GTTCCTCAGCTGAAAGTTTAGGG - Intergenic
908578105 1:65483138-65483160 GTTCATCAGGAGACACTGTAAGG + Intronic
910494783 1:87814630-87814652 GTTCTTCAACACACTGTGGATGG - Intergenic
913673580 1:121120972-121120994 GTCCTTCAGCAGAAATTATAAGG + Intergenic
913995767 1:143651262-143651284 TTTCTTCAGCAAATAGTATAAGG - Intergenic
914025357 1:143908325-143908347 GTCCTTCAGCAGAAATTATAAGG + Intergenic
914234687 1:145798401-145798423 TCTCTTCAGCAAACAGTGTTGGG - Intronic
914474521 1:148012386-148012408 TTTCTTCAGCAAACAGTAAAAGG - Intergenic
914492094 1:148158700-148158722 TTTCTTCAGCAAACAGTAAAAGG - Intergenic
914663793 1:149816045-149816067 GTCCTTCAGCAGAAATTATAAGG + Intergenic
920220224 1:204392434-204392456 GTTATTCAGCTCACAATGTAGGG - Intergenic
922036695 1:221855144-221855166 GTTCTTCAGAAGATAATGTTAGG + Intergenic
923451916 1:234125905-234125927 GTTCTTCATCACACACTGCACGG - Intronic
924029669 1:239873625-239873647 GTTTTTCAACAGACAGTGATAGG - Intronic
924299685 1:242624993-242625015 TTGCTTGAGCAGACAGAGTATGG - Intergenic
1062847066 10:715854-715876 TTTTTTCAACAGACAGTGTTGGG - Intergenic
1064100329 10:12458168-12458190 GTGCAACAGCAGACAGTGCATGG - Intronic
1066686958 10:37990750-37990772 CCTCTTCAGAAGACAGTGTGGGG - Intergenic
1067767805 10:49100934-49100956 CCTCTTCAACAGACAGTGTAGGG + Intronic
1070342729 10:75512371-75512393 CTTCTCCAGCTGACAGAGTATGG + Intronic
1071296289 10:84222443-84222465 GTTGTCAAGCAGACAGTGCATGG - Exonic
1071930894 10:90468604-90468626 TTTCTCCAGCAAACAGTGTTGGG + Intergenic
1071984018 10:91032680-91032702 GTTCTTTAAGAGACTGTGTAAGG - Intergenic
1072896786 10:99374297-99374319 GTCCTTCATCACACAGTGGATGG + Intronic
1074941051 10:118236268-118236290 GTTCTTCAGCAGAAGGTCTGTGG + Intergenic
1075078478 10:119367502-119367524 GTTCTTGGGCAGACAGGGTTGGG + Intronic
1077280796 11:1744489-1744511 GGTCATCAGGAGACAGTGTGTGG + Intronic
1078682612 11:13492359-13492381 GTTCTGCTCTAGACAGTGTAGGG - Exonic
1080458235 11:32433938-32433960 GTTCTACCGCAGGCAGTGGAAGG - Intronic
1082641210 11:55663782-55663804 GTTGTTCTGCATTCAGTGTAAGG + Intergenic
1083187571 11:61026562-61026584 GTGCCTGAGCAGACAGTGGAAGG + Intergenic
1085502494 11:77036978-77037000 GTTCTTAAGTAGACAGAGCAGGG + Intronic
1086861468 11:91929694-91929716 ATTCTTTAGGAGACAGTGTTTGG + Intergenic
1088107069 11:106219440-106219462 ATTCTTTAGCCAACAGTGTAAGG + Intergenic
1093063581 12:14632776-14632798 GTGCTTCAGCCTACCGTGTAGGG + Intronic
1096122628 12:49097984-49098006 GGTCTTCACCAGACAGAGTGTGG + Exonic
1098486555 12:71028253-71028275 GTTTTTCAACAGACAGGGGAGGG - Intergenic
1098784454 12:74733062-74733084 GGTCTCCAGCAGACAGCATATGG - Intergenic
1099757767 12:86876719-86876741 GTGCTTTAGCACACAGTGTTGGG + Intergenic
1106371364 13:29136974-29136996 ATTCTTCAGCAGACACTAAATGG - Intronic
1106695494 13:32168217-32168239 GTTCTACAGCAGACTGTGTTTGG - Intronic
1108711657 13:53038948-53038970 GTTCTTCAGCTGACACTTAAAGG - Intronic
1110247498 13:73342871-73342893 GTTTTTCCACAGACAGTGTGTGG - Intergenic
1110383320 13:74879077-74879099 GATCATCAGCAGTCACTGTAGGG - Intergenic
1112646205 13:101335129-101335151 GTTTTTCATCAGACAGTGAAAGG - Intronic
1113082094 13:106530939-106530961 GTTCTTCAGCTGACTCTGTCTGG + Intronic
1113555704 13:111232270-111232292 TTAGTTCTGCAGACAGTGTATGG - Intronic
1116084053 14:40212926-40212948 GTTCTTCTACACACAATGTATGG - Intergenic
1127908755 15:63397868-63397890 GTTGCTTAGTAGACAGTGTAGGG - Intergenic
1132223497 15:100123137-100123159 GGGCTTCAGGAGACAGTGTGCGG + Intronic
1133466578 16:6033133-6033155 GTTCCTCCGCAGACATTGTTTGG + Intronic
1133774442 16:8886149-8886171 GTTCTCCAGCAGCCAGTGGCCGG + Intergenic
1134120793 16:11583417-11583439 GTTTTTCATCAAACAGTGCAAGG + Intronic
1136347625 16:29686284-29686306 GTTCACCTGCAGACAGTGTCGGG - Intronic
1138016872 16:53435861-53435883 GGTCTGCAGAAGATAGTGTATGG + Intronic
1138992463 16:62408656-62408678 GTGCTCCAGCAGTCAATGTATGG - Intergenic
1140271558 16:73470776-73470798 GTTTTTCAGCACCCTGTGTAGGG - Intergenic
1141999874 16:87658159-87658181 GGTATTCAGCAAACAGTGAATGG + Intronic
1144623705 17:16833803-16833825 GTTCTTCAGCTGGGAGTGTGGGG - Intergenic
1145149508 17:20505473-20505495 GTTCTTCAGCTGGGAGTGTGGGG - Intergenic
1146891632 17:36510156-36510178 ATTCTTCAGCAGGCCTTGTAAGG - Intronic
1147050196 17:37788623-37788645 GTTCTTAAGGAGTCAGTGTGTGG + Intergenic
1147578040 17:41613735-41613757 GTTCTTCAGCTGGGAGTGTGGGG - Intronic
1149646872 17:58247465-58247487 GGTCTTCAGCCTACAGTGGAGGG - Exonic
1160131153 18:76225983-76226005 TTTCCTGAGCAGACAGTGCAGGG + Intergenic
1164423630 19:28119900-28119922 GTTTTCCAGAGGACAGTGTAGGG - Intergenic
1165079467 19:33299249-33299271 GTTCTTGAACAGCCAGTGTGTGG + Intergenic
1167046734 19:47054154-47054176 GTTCTTGAGAAGACAGGCTAAGG + Intergenic
926251801 2:11159186-11159208 GTTCTTCAGCACTCAGTGGCTGG + Intronic
927208994 2:20627277-20627299 GTTTCTGAGCAGACAGTGTGGGG - Intronic
927403164 2:22737409-22737431 TCTCTTCAACAGACAGTGTTGGG + Intergenic
937880102 2:126858424-126858446 GTGCTTCAGCAGCCAGAGAAAGG - Intergenic
939483986 2:142785981-142786003 GTTCTCCAGCAGACTGTCTTAGG + Intergenic
940129575 2:150365614-150365636 CTTCTTCAGGAGAAGGTGTAAGG - Intergenic
940726575 2:157342557-157342579 GTTCTTGAGAACACAGGGTAAGG + Intergenic
941532343 2:166685961-166685983 TTTCTTCAGCAAACAGTCTGTGG - Intergenic
943283117 2:185963280-185963302 GTGTTTCAGAAGACAGTGTAAGG + Intergenic
944641221 2:201727869-201727891 GTTCTGCAGCAGAGACTGCAAGG - Intronic
1171362337 20:24596773-24596795 ATTCTTCAGCAGTCAGTGCCGGG + Intronic
1173799520 20:45886450-45886472 GTTCTTGGGCAGACAGGGTTGGG - Intergenic
1177719775 21:24891044-24891066 CTTCTTAAGCAGACAGGCTATGG - Intergenic
1178549984 21:33528879-33528901 GTTCTTCAGAGGACAGTGGATGG - Exonic
1181387124 22:22554658-22554680 GTTCTTCCCCAGACAGAGTCAGG - Intronic
1182259209 22:29060884-29060906 GTTCTTCAGCAGAGAATAAAAGG + Intronic
1183139781 22:35926147-35926169 GTTCTTCAACAGACAGTCACTGG - Intronic
1184064505 22:42109792-42109814 TTTCTGCAGCAGACAAGGTAGGG + Intergenic
1184133410 22:42531501-42531523 GTTCCTCAGCAGACCGTGAAAGG + Intergenic
949190534 3:1244196-1244218 GTTCTTGAGCACACAGGCTAAGG + Intronic
949533004 3:4976095-4976117 CTCATTCAGCACACAGTGTAAGG + Intergenic
950873619 3:16250338-16250360 GTTTTTCAGAAGACACAGTAAGG - Intergenic
951149874 3:19276067-19276089 TTTCTTCAGCAGAAAGAGTGGGG - Intronic
953588273 3:44225531-44225553 TCTCTTCAGCAGACAGTGCTAGG - Intergenic
954326392 3:49866527-49866549 GTTCCTCTGCAGAGAGTGGAGGG - Intronic
955253222 3:57304962-57304984 GTTCTTCAGAACACAGGCTAAGG - Intronic
956396938 3:68835953-68835975 GTTCTTCAACACAAAGTGAAAGG - Intronic
959239994 3:103778669-103778691 CTTCCTCAGCACACAATGTATGG - Intergenic
960194814 3:114752753-114752775 GTTCTGAGGCAGACAGAGTAAGG - Intronic
960699700 3:120428046-120428068 CTACCTCAGAAGACAGTGTAAGG - Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961730443 3:128961020-128961042 GTTCTTGAGCACACAGGCTAAGG - Intronic
962363091 3:134757817-134757839 GGTCTGCAGGAGACAGTGTTAGG + Intronic
963087416 3:141451107-141451129 GGACTTCAGCAGAGAGTGGAAGG + Intergenic
965070191 3:163908848-163908870 GTTCTTCAGAACACAGGCTAAGG - Intergenic
968011659 3:195284132-195284154 CTTCATCAGCAGACACCGTAAGG + Intronic
968494823 4:909864-909886 GTTCTTCATCTGACACTGTGGGG - Intronic
970183462 4:13423648-13423670 GAGCTTCAACAGACACTGTAGGG + Intronic
971712810 4:30138615-30138637 TTTCTTTAGCAGTCAATGTAAGG + Intergenic
972873679 4:43331103-43331125 CTTCTACAGCAGATAGTGTTAGG - Intergenic
974903510 4:68031113-68031135 GTTCTCCGGCAGACAGGGGAGGG - Intergenic
975122342 4:70742583-70742605 GTTCTGCAGCAGCAAGTGAATGG - Intronic
977041876 4:92027134-92027156 GTTCTTGAGCACACAGGCTAAGG - Intergenic
977886736 4:102260176-102260198 GTTCTTATGCAGCCAGTTTAGGG - Intronic
980097887 4:128512114-128512136 GTACTTCAGCAGGCACTGCAGGG - Intergenic
980335247 4:131464977-131464999 TTTCTTCAACAGACGGTGTGGGG - Intergenic
981348054 4:143698921-143698943 GTTCTCCAGCACAAAGTGGATGG + Exonic
981492549 4:145355246-145355268 GTTCTTCAGCAGACTGCCTTTGG - Intergenic
985533444 5:447469-447491 GTTCTTCAGGAGGCAGCGCATGG + Intronic
988894310 5:35655545-35655567 TTGCTTCAGGAGACAGTGTCTGG + Intronic
989266210 5:39476949-39476971 GTTCTCCAGCAGCCAGTTTTGGG - Intergenic
991369775 5:65906157-65906179 GATCTTCAGCAGCCAGAGTCGGG + Intergenic
992458468 5:76938549-76938571 GTTCATCAGAAGACACTGTGGGG - Intergenic
995251902 5:110002990-110003012 GTTCTGCGGCAGACAGCCTATGG - Intergenic
996825752 5:127679194-127679216 GTTCTCCAGAAGACCATGTATGG + Intergenic
997953433 5:138259949-138259971 GGTGCTCAGCACACAGTGTAGGG + Intronic
999394112 5:151215636-151215658 GTTCTTCAGCAGACAGTGTAAGG + Intronic
1003177087 6:3760034-3760056 GTTATTCAGCAAACAGCCTATGG + Intergenic
1004241557 6:13926940-13926962 GTTCTTCAGCACTCAGATTAAGG - Intronic
1006893799 6:37452888-37452910 GTTATTGAGCAGCCTGTGTAGGG + Intronic
1007261607 6:40567935-40567957 GTTCTTGAGCAGGCTGTTTAGGG - Intronic
1012777212 6:103512631-103512653 GTACTTCAGAATACAGTGAAGGG + Intergenic
1012975133 6:105772542-105772564 GTTCTTCAGCACACAGATTTTGG + Intergenic
1013438861 6:110140602-110140624 ATTCTTCAGCAGACACTGGCTGG - Intronic
1013783631 6:113755516-113755538 ATACTTCAGCAGACAGTACAGGG + Intergenic
1018508848 6:164503300-164503322 GTTTTGCAGCACTCAGTGTAGGG + Intergenic
1018931447 6:168242737-168242759 GTTCTTCAGCAGAACATGTTTGG - Intergenic
1019771442 7:2886094-2886116 CTTCTTCAGGAGACAGAGAAGGG - Intergenic
1022710185 7:32842310-32842332 GTTCTTGAGCACACAGGCTAAGG + Intergenic
1022854853 7:34304299-34304321 GTTCTTGAGAAGACAGGCTAAGG + Intergenic
1024182852 7:46915159-46915181 GTTCTTCAGTAGACTGGATAAGG - Intergenic
1025965875 7:66270610-66270632 GTTCTTCAAAAAATAGTGTATGG - Intronic
1026975545 7:74495590-74495612 GTTCTCCAGGAGCCAGTGCATGG + Intronic
1029972090 7:104799773-104799795 GTTCTTCAGGGCACAGTGTGTGG - Intronic
1030457272 7:109791689-109791711 GTTCTCCAGAAGACCGTGTATGG - Intergenic
1030831913 7:114234303-114234325 TTTCTTTAGGAGACAGTGTTAGG + Intronic
1031399850 7:121316874-121316896 GTTCTTGAGCACACAGGCTAAGG - Intergenic
1034485869 7:151361851-151361873 TCTCTTCTGCAAACAGTGTAGGG + Intronic
1035090016 7:156302358-156302380 GTTCTTCAGAAGACACTGTTAGG + Intergenic
1036103322 8:5811836-5811858 CATATTCAGCAGACAGTGCAAGG + Intergenic
1037795323 8:21988633-21988655 ATTCTGCAGCTGACAGTGGATGG + Intronic
1039901446 8:41755671-41755693 GTTGTTCAGGAGACAGGGTCTGG - Intronic
1045364627 8:101464316-101464338 GTTTTTCAACAGACGGTGCAGGG + Intergenic
1050336242 9:4592570-4592592 GTTCTTCACCAGGCATTGTAAGG + Intronic
1051201011 9:14623876-14623898 GTTCTTCCCCAGACTGTGTAAGG - Intronic
1052186132 9:25596520-25596542 TTTCTTCAACAGATAGTGTTGGG - Intergenic
1052828542 9:33195767-33195789 GTTTTTCAGATGGCAGTGTAAGG - Intergenic
1055317958 9:75053202-75053224 GTTCTACATCAGACAGTCAATGG - Intergenic
1058703590 9:107620817-107620839 TTTCTTCTGCAGACAATGTTTGG + Intergenic
1185960830 X:4544894-4544916 GTTCTTGAGCACACAGGCTAAGG + Intergenic
1187269641 X:17768235-17768257 ATTCTTCAGCAGACAGCCTCAGG + Intergenic
1187779158 X:22798150-22798172 GATCTTTAGCAGAATGTGTAGGG - Intergenic
1195239030 X:102932817-102932839 GTTCTGCAGTAAACAGTGCAAGG - Intergenic
1196387690 X:115176041-115176063 GTTCTCCAGCAGACACTGACTGG - Intronic
1201307642 Y:12564365-12564387 GTTCTTCAGAACACAGGCTAAGG + Intergenic