ID: 999397360

View in Genome Browser
Species Human (GRCh38)
Location 5:151238550-151238572
Sequence AAGTTTTATTTTTAGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 487}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999397360_999397364 0 Left 999397360 5:151238550-151238572 CCCAGCAGCTAAAAATAAAACTT 0: 1
1: 0
2: 2
3: 43
4: 487
Right 999397364 5:151238573-151238595 CCGCTCCCCCTCCTGCCCTTGGG 0: 1
1: 0
2: 4
3: 39
4: 387
999397360_999397367 6 Left 999397360 5:151238550-151238572 CCCAGCAGCTAAAAATAAAACTT 0: 1
1: 0
2: 2
3: 43
4: 487
Right 999397367 5:151238579-151238601 CCCCTCCTGCCCTTGGGCTCTGG 0: 1
1: 0
2: 6
3: 69
4: 571
999397360_999397374 28 Left 999397360 5:151238550-151238572 CCCAGCAGCTAAAAATAAAACTT 0: 1
1: 0
2: 2
3: 43
4: 487
Right 999397374 5:151238601-151238623 GCGACCTCCTCAGCCCCATCGGG 0: 1
1: 0
2: 1
3: 12
4: 156
999397360_999397373 27 Left 999397360 5:151238550-151238572 CCCAGCAGCTAAAAATAAAACTT 0: 1
1: 0
2: 2
3: 43
4: 487
Right 999397373 5:151238600-151238622 GGCGACCTCCTCAGCCCCATCGG No data
999397360_999397362 -1 Left 999397360 5:151238550-151238572 CCCAGCAGCTAAAAATAAAACTT 0: 1
1: 0
2: 2
3: 43
4: 487
Right 999397362 5:151238572-151238594 TCCGCTCCCCCTCCTGCCCTTGG 0: 1
1: 1
2: 1
3: 45
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999397360 Original CRISPR AAGTTTTATTTTTAGCTGCT GGG (reversed) Intronic
900456903 1:2779625-2779647 TAGTTCTATTTTTAGCTTTTTGG + Intronic
900515030 1:3077644-3077666 GAGTTTTGTTTTTATCTCCTTGG + Intronic
901100824 1:6717248-6717270 AATTTTTATTTTTAGTGACTGGG + Intergenic
901505907 1:9685652-9685674 AATTTTTAATTATAACTGCTGGG - Intronic
903971058 1:27119165-27119187 ATGTTTTATTTATATCTCCTCGG + Intronic
904734735 1:32622702-32622724 AACTTTTATTTTTAGGTTCATGG - Intronic
905592780 1:39179145-39179167 CAATTTCATTTTTAGCTGCAAGG + Intronic
906416987 1:45627789-45627811 TTATTTTATTTTTGGCTGCTCGG - Exonic
907584736 1:55607234-55607256 AATTTTTATTTTTTTGTGCTTGG + Intergenic
908107887 1:60864678-60864700 AAATTTTTTTTTTAACTCCTTGG + Intergenic
908111291 1:60901151-60901173 AACTTTTATTTTTAGATACAGGG + Intronic
908249770 1:62256061-62256083 AAGCATTATTTTTAGCTCATCGG + Intronic
909315275 1:74209749-74209771 ACATTTTATTTTGGGCTGCTTGG + Intronic
909762853 1:79314423-79314445 AACTCTGATTTTTAGCTGCTAGG - Intergenic
909812783 1:79952486-79952508 AGGCTTTATTTTTATCTCCTTGG + Intergenic
909857508 1:80556768-80556790 AAGTTGTATTCTTAATTGCTTGG - Intergenic
909864010 1:80643658-80643680 AACTATTATTTTTAGTTGCCTGG - Intergenic
910972361 1:92869015-92869037 AAGTTATTTTTCTAGGTGCTAGG - Intronic
911464913 1:98239324-98239346 AACTTTTATTTTTAGTTTATGGG - Intergenic
911617495 1:100030762-100030784 AAGTTTTATTTTATTCTGCTTGG + Intergenic
911638090 1:100258225-100258247 TAATTTTCTCTTTAGCTGCTTGG + Intergenic
911711814 1:101082209-101082231 AAGTTTTATTTTTAACCAGTTGG - Intergenic
913163730 1:116167433-116167455 AAGGTTTATTTTTAGAGTCTAGG - Intergenic
913690506 1:121275517-121275539 AAGTAGTAATTTTAGCTCCTAGG - Intronic
914147036 1:145004441-145004463 AAGTAGTAATTTTAGCTCCTAGG + Intronic
915060047 1:153173981-153174003 TAGTTTAATTTTTAGCAGATGGG + Intergenic
916356260 1:163912220-163912242 AAGTTTTCTTTTTAGGTTTTTGG - Intergenic
917025960 1:170641872-170641894 CATTTTTAGTTTTACCTGCTTGG - Intergenic
917189865 1:172403638-172403660 AAGTTGTATTTGTAGCTGCAGGG - Intronic
919985692 1:202672883-202672905 TCTTTTTATTTTTTGCTGCTTGG - Intronic
920477824 1:206294006-206294028 AAGTAGTAATTTTAGCTCCTAGG - Intronic
920529745 1:206693226-206693248 CAGGTTTATTTTTAGCTGTTCGG - Intronic
921343096 1:214154050-214154072 AAGTTTTATGTTTAGCCCATTGG + Intergenic
921345722 1:214182967-214182989 AAGATTTCTTTTTATTTGCTTGG - Intergenic
922687962 1:227662388-227662410 AAGTTTTATTTTTTTCTGTTTGG + Exonic
923877749 1:238068153-238068175 AAATTTTATTTTTAGAACCTAGG - Intergenic
924492516 1:244552996-244553018 TAATTTTATTTTTAGTTGTTGGG - Intronic
924526791 1:244859694-244859716 AAATTTTATTTTTAACTCTTTGG + Intronic
924725976 1:246671029-246671051 AAGTTTTATTTTTTTCTAATTGG - Intergenic
1063497916 10:6527222-6527244 AAGTTGTATTTTCAGCAGCCAGG + Intronic
1063557307 10:7093054-7093076 AAATTTTATTTTAAGTTCCTGGG - Intergenic
1064420292 10:15185061-15185083 CAATTTTATTTTTAGTTTCTGGG + Intergenic
1064922696 10:20535585-20535607 ACGTTGTATTTTTATCTGTTTGG - Intergenic
1065101732 10:22337469-22337491 AAGTCTTTTATTTAGCTACTAGG + Intergenic
1065601132 10:27369846-27369868 CAGCTTTATTTCTAGCTGCTTGG + Intergenic
1066052658 10:31649530-31649552 AAAATTTATTTATAACTGCTAGG - Intergenic
1066194667 10:33087411-33087433 CACTTTTATCATTAGCTGCTGGG + Intergenic
1066473849 10:35725338-35725360 AAATTTTATTTTTAGATACAGGG - Intergenic
1066563512 10:36695234-36695256 AAGTTTTGCTTTTTGCTTCTGGG - Intergenic
1066792956 10:39086323-39086345 AAGTTTTATTTTTAATCACTAGG + Intergenic
1067676662 10:48385875-48385897 GAATTTTATTTTTTTCTGCTGGG + Intronic
1068185401 10:53578681-53578703 AAGTTTTATTTTTAAATTCTTGG - Intergenic
1068198493 10:53749562-53749584 AAGTTTTATTTTTATATTTTTGG + Intergenic
1068363820 10:56016881-56016903 AATTTTTATTTTAAGTTCCTGGG - Intergenic
1068470144 10:57450799-57450821 AAGTGTTTTCTTTAGCTACTAGG - Intergenic
1068525370 10:58122958-58122980 AGGTTTTATGTTTATCTGCTAGG - Intergenic
1068728989 10:60335283-60335305 AAACTTTTTTTCTAGCTGCTTGG - Intronic
1068733798 10:60389323-60389345 AAGGGTTATTTTTACATGCTGGG - Intronic
1069133933 10:64740673-64740695 AATTTTTTTTTTTGGCTGCCCGG + Intergenic
1069364436 10:67682484-67682506 AATTTTCAATTTTGGCTGCTTGG - Intronic
1069798326 10:71067293-71067315 AAGTCATATTTTTGGTTGCTGGG + Intergenic
1071325711 10:84514822-84514844 AAGTTTTATTTTTCCTTGCCAGG + Exonic
1071678325 10:87678580-87678602 AATTTTTTTTTTACGCTGCTGGG - Intronic
1071823885 10:89304971-89304993 AAATTTTATTTTTCTCTTCTGGG - Intronic
1072103574 10:92252631-92252653 AATTTTTATTTTTTGTAGCTGGG + Intronic
1073831631 10:107390601-107390623 AATTTTTAATTTTAGATGTTGGG - Intergenic
1073943795 10:108728830-108728852 TAGTTTTATTTTTAGTTCCTTGG - Intergenic
1074233234 10:111558651-111558673 GATACTTATTTTTAGCTGCTGGG + Intergenic
1074610861 10:115020071-115020093 AGGTTTTGTTTTAAGATGCTTGG - Intergenic
1074634437 10:115297250-115297272 AAGTATTATTTTTAGCATATGGG + Intronic
1075616824 10:123896061-123896083 GAGATTTATGTTAAGCTGCTTGG + Intronic
1077833136 11:5897666-5897688 TAGTTCTATTTTTAGTTCCTTGG + Intronic
1077988139 11:7375983-7376005 AAATTTTATTTCTTTCTGCTGGG + Intronic
1078632745 11:13018300-13018322 AACTTTTATTTTAAGCTCCAGGG - Intergenic
1079841926 11:25414317-25414339 AAGTTTTGTTTTCATCTGTTTGG - Intergenic
1079851791 11:25544187-25544209 AATTTTTATTTTTAAGTTCTGGG - Intergenic
1079971741 11:27043375-27043397 AAGTTATACTTTTAAGTGCTGGG + Intronic
1080220699 11:29899970-29899992 AGTTTTTTTTTTTAGCTGTTTGG - Intergenic
1080312169 11:30907228-30907250 CAGTTTTGTTTTTATTTGCTTGG - Intronic
1080671192 11:34379752-34379774 AAGTTTAATCTTTAGCAGGTAGG + Intergenic
1080800123 11:35602667-35602689 TATTTTTAATTTTAGTTGCTAGG - Intergenic
1080862317 11:36160486-36160508 ATATTTTATTTTTTGCTGCAAGG - Intronic
1081040346 11:38202125-38202147 ATTTTTTATTTTTCTCTGCTTGG - Intergenic
1081480564 11:43484415-43484437 AAGTTTTATCTCTTGCTGCACGG - Intronic
1081562730 11:44233252-44233274 CAGTTTTATATTTTGCTGGTGGG - Intronic
1082055642 11:47813698-47813720 CAGCTTTAATTCTAGCTGCTAGG + Intronic
1084379264 11:68800659-68800681 CAGTTTTACTTTTTGTTGCTGGG - Intronic
1085232587 11:74985466-74985488 TAATTTTATTTTTACCTCCTTGG + Intergenic
1085504178 11:77047061-77047083 GAGTTTTATTTTTTGTTGTTGGG - Intergenic
1085647733 11:78238172-78238194 AACTTTTATTTTAAGTTGCAGGG - Intronic
1085980257 11:81716225-81716247 CAATTTTATTTTTATCTGCTTGG - Intergenic
1086051183 11:82592475-82592497 AAGTTATATTGTTAGATGCATGG - Intergenic
1086226395 11:84515567-84515589 ATGTTATATGTTTAGGTGCTTGG - Intronic
1086228870 11:84545007-84545029 ATGTTTTCTTTGTAGCAGCTAGG + Intronic
1087028082 11:93671835-93671857 CATTTATATTTTTATCTGCTTGG - Intronic
1088150178 11:106735675-106735697 TAGTTTTATTTTTAGATTTTTGG + Intronic
1088468080 11:110163533-110163555 AAGAATTATTTTTACCTGTTTGG + Intronic
1088495666 11:110429669-110429691 CAGTTTTTTTTTTAACGGCTAGG + Intergenic
1089193477 11:116674930-116674952 AAGTTTTATTTTTAGTTCAGGGG - Intergenic
1089193791 11:116678954-116678976 AAAATTTATTTTTAGCTTATAGG - Intergenic
1089222412 11:116884942-116884964 AACATTTATTTTCAGTTGCTCGG + Intronic
1090630515 11:128643415-128643437 AACTTTTATTTTTAGATTCGGGG - Intergenic
1090686935 11:129131939-129131961 AATTTTTATTTTTAAGTTCTGGG + Intronic
1091403919 12:197237-197259 AGGTTTTAATTTTAGCATCTGGG - Intronic
1092636508 12:10456431-10456453 AACTTTTATTTTTAGATACAGGG + Intergenic
1093240188 12:16660592-16660614 AACTCTTATTTTTTGCTGGTGGG + Intergenic
1094565212 12:31592242-31592264 AAGTTTTATTTTTACTTACATGG - Intergenic
1094803243 12:34063259-34063281 TAGATTTATTTTAAGCTGCAAGG + Intergenic
1096825307 12:54271659-54271681 AAGCTTTATTATTAGCTTTTAGG + Intronic
1096913322 12:55006029-55006051 AACTTTTATTTTAAGTTGCGGGG + Intergenic
1097751683 12:63361775-63361797 AACTTTTATTTTTAGATCCAGGG + Intergenic
1098372123 12:69770701-69770723 AAGTTTGATTTTTAACTGACAGG + Intronic
1098507914 12:71275919-71275941 TTATTTTATTTTTAGCTACTAGG - Intronic
1099645036 12:85342102-85342124 AAGTTTAATTTTTAGCTTGTAGG - Intergenic
1099660329 12:85550028-85550050 GAGCTTAAATTTTAGCTGCTGGG + Intergenic
1100007772 12:89914404-89914426 AAGATTTATTTTATTCTGCTTGG + Intergenic
1100514929 12:95318197-95318219 AGGTTTTCTTTTTATCTGGTTGG + Intergenic
1100892488 12:99141424-99141446 AACTTTTATTTTAAGTTCCTAGG + Intronic
1100969290 12:100050351-100050373 AAATTTTGTTTTGAACTGCTTGG - Intronic
1101073818 12:101107185-101107207 CAGTTTTATTTCTACCTGATAGG + Intronic
1101559642 12:105844300-105844322 ATGTTCTATCTTTAGGTGCTGGG + Intergenic
1102640929 12:114365991-114366013 AACTTTTTGTTTTAGCTGTTTGG + Intronic
1103484778 12:121275160-121275182 ACTTTTTATTTTTAAATGCTGGG + Intronic
1104193400 12:126506413-126506435 AAGTTTTTTTTTTAAGTTCTGGG + Intergenic
1105050706 12:133048127-133048149 GCCTTTTATTTTTAGTTGCTGGG + Intronic
1105709055 13:22988181-22988203 CAGTTTTGTTTTTGTCTGCTTGG - Intergenic
1105835061 13:24202978-24203000 AAGTTTTATTTTAAGTTCCTGGG + Intronic
1106444601 13:29815610-29815632 AAGTTTTATTTTATGGTTCTGGG - Intronic
1106455767 13:29925216-29925238 AAGTTTTATTTTCAGCTGTGGGG - Intergenic
1106605931 13:31228844-31228866 AAGTTAGATTTTCAGCTACTGGG + Intronic
1106729298 13:32522952-32522974 AACTATGATTTTTAGCTACTTGG - Intronic
1106780312 13:33052538-33052560 AACTTTTCTTTTTAGTTTCTTGG - Intronic
1107283526 13:38763662-38763684 AAGGTTTATTTTCTGCTGATAGG + Intronic
1108072423 13:46641906-46641928 TTGTTTTATTTCTGGCTGCTCGG + Intronic
1108145259 13:47470182-47470204 GAGTTTTATTTTCACCTTCTAGG + Intergenic
1108605931 13:52038604-52038626 GTTTTTTATTTTTAGCAGCTAGG + Intronic
1108888762 13:55226330-55226352 AAGTTTTGCTTTTTGCTTCTTGG + Intergenic
1109523737 13:63546372-63546394 ACGTTTTATTTTTAGTTCCAAGG - Intergenic
1109553895 13:63944126-63944148 AAATATTTTTTCTAGCTGCTTGG + Intergenic
1109765384 13:66888912-66888934 CATTTTTATTTTTAGCTCTTTGG - Intronic
1109913249 13:68944549-68944571 TAGTGTTATTTTTATCTGTTTGG - Intergenic
1110029456 13:70588361-70588383 AGGTTTTAATTATAGCTACTTGG - Intergenic
1110088687 13:71416457-71416479 AAATTTTATTTTCAGCTTCAGGG + Intergenic
1110397441 13:75048061-75048083 CAGTTTTATTTTTAGTTCTTTGG - Intergenic
1110934300 13:81265813-81265835 AATTTTTATTTTTAGCTTTTTGG - Intergenic
1111254628 13:85650309-85650331 AAGGTTTATTTCTAGCTGAATGG - Intergenic
1111479715 13:88809145-88809167 AAATTTTATTTTTAGTTTGTTGG - Intergenic
1111692705 13:91584387-91584409 AAGTTTTATTTTTTCCTCTTTGG - Intronic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112633329 13:101185762-101185784 ACATTTTATTTTTCGCTGCTTGG + Intronic
1112636032 13:101219065-101219087 AAGTTATATTTTGAGGTTCTGGG + Intronic
1113257239 13:108519665-108519687 AAGTTTGATTTTTTTCTGGTGGG - Intergenic
1115091180 14:29577864-29577886 AAGCTATATTTTTAAATGCTAGG - Intronic
1115155445 14:30333714-30333736 AAGTTTTCTTATCAGCTGCTTGG + Intergenic
1115212406 14:30980906-30980928 AAGTTTTTTTTTTAATTCCTTGG - Intronic
1115757871 14:36547701-36547723 TATTTATATTTTTAGCAGCTGGG + Intergenic
1115931730 14:38504344-38504366 TAGTTTTATTTTTTTCTACTTGG - Intergenic
1116349763 14:43846205-43846227 AAGTTTTATTATGTGCTGCATGG - Intergenic
1116674291 14:47885729-47885751 AAGTTTTATTTTAAGCTCATGGG + Intergenic
1117869739 14:60187463-60187485 AAGTTTTATTTTTATGAGCTAGG + Intergenic
1117881048 14:60314027-60314049 AAGTTGTATCTCTAGTTGCTTGG - Intergenic
1119183454 14:72619688-72619710 AAGTTGAAATTTCAGCTGCTTGG + Intronic
1119271209 14:73307003-73307025 TAGCTTTATTTTTATCTGATAGG - Intronic
1119384657 14:74250248-74250270 AATTTTTTTTTTTAAATGCTAGG + Intronic
1119644038 14:76335750-76335772 AAGTTGGACTTTTACCTGCTGGG + Intronic
1120018552 14:79501877-79501899 TAGTTATATTTTTATCTGATTGG + Intronic
1121746550 14:96299471-96299493 AAGTTTTATATTAGGATGCTGGG - Intronic
1121940040 14:98061766-98061788 AATTTTTATTTTTAAGTTCTGGG - Intergenic
1124806881 15:32892966-32892988 AAGCTTTATTTTTGGTTGATGGG + Intronic
1124906718 15:33875510-33875532 AAGTGTTATTTAAAGCTGCAAGG + Intronic
1125373880 15:39007152-39007174 AATTTTTATTTTTAGTTCCAGGG - Intergenic
1126035973 15:44546120-44546142 CACTTTTATTTTTAGCTCTTTGG + Intronic
1128198272 15:65780032-65780054 AAATTTTTTTTTTCCCTGCTAGG - Intronic
1129045907 15:72733815-72733837 TAGTTGTATTTTTAGCTCTTTGG + Intronic
1129900118 15:79141079-79141101 AAGTTTTATAATTATCTGCCTGG + Intergenic
1130433288 15:83871148-83871170 AAGTTTGTTTTTTAACTGTTAGG - Intronic
1131361854 15:91799698-91799720 AATTTTTATTTTTAGTTCCGGGG - Intergenic
1131572409 15:93552573-93552595 TAGTTTTATTTTTGTTTGCTTGG + Intergenic
1132238900 15:100242429-100242451 AAGTTTCTTTTTTGGTTGCTAGG - Intronic
1134019804 16:10913634-10913656 GAGTTTTATTTTTAACTGTGAGG - Intronic
1135696844 16:24595726-24595748 AAGTTTTTTTTTTATTAGCTGGG - Intergenic
1135860574 16:26052027-26052049 AAATATTATTTTGACCTGCTGGG + Intronic
1135951912 16:26922227-26922249 AACTTTTATTTTAAGTTCCTGGG - Intergenic
1136410221 16:30072175-30072197 AAGTTTTATTTTTATTTTTTGGG - Intergenic
1137271911 16:46907793-46907815 AAGTTTTAATTTTGGCTGGGAGG + Intronic
1137312527 16:47279330-47279352 AAGGTTTTTTTTTCCCTGCTAGG + Intronic
1137504227 16:49037376-49037398 AACTTTTATTTTTAGGTTCAGGG - Intergenic
1137967418 16:52950156-52950178 TAGTTCTATTTTTAGCTTTTTGG + Intergenic
1137970323 16:52978259-52978281 AATTTTTATTTTTAGTTCCGGGG + Intergenic
1139112945 16:63914481-63914503 AAGTTTTAGTTTTGGTTGGTTGG - Intergenic
1140090635 16:71835603-71835625 AAGTTTCATTTTTTGAGGCTGGG - Intergenic
1140246172 16:73252124-73252146 AGAGATTATTTTTAGCTGCTGGG + Intergenic
1141457502 16:84153381-84153403 AAGTTTTATTTTAAGTTGATGGG - Intronic
1142392495 16:89811247-89811269 CAGTTTTATTGTGAGCTGCTTGG - Intronic
1143413351 17:6726255-6726277 AAGTTTTATTTTTGCCTGGTTGG + Intergenic
1143674661 17:8423141-8423163 AAGTTTTAGTTTTAAATGGTTGG + Intronic
1144177835 17:12724270-12724292 AAGATTTATTTTTACATGATAGG + Intronic
1146531971 17:33615605-33615627 TAGTTTTAATTTTAACTTCTGGG + Intronic
1146777418 17:35633747-35633769 AAGAATTATTGTTAGTTGCTGGG - Intronic
1146780363 17:35665463-35665485 AAGTATGGTTTTTAGCTACTAGG - Intronic
1148510793 17:48167838-48167860 AAGTTTTATTTTTGGTTACCTGG + Intronic
1149427812 17:56571655-56571677 AAGGTTAACTTTTAGCTGTTGGG - Intergenic
1149455388 17:56783825-56783847 AATTTTTATTTTTAAGTTCTGGG + Intergenic
1149690155 17:58568651-58568673 AAATTTTATTTGCAGCTGATTGG - Intronic
1149797665 17:59535632-59535654 TAGGTTTATTTATAGCTACTTGG + Intergenic
1150466366 17:65396102-65396124 ATGTGTTATTTTTAGCCTCTGGG - Intergenic
1150901615 17:69283938-69283960 TAGTTCTGTTTTTACCTGCTTGG + Exonic
1151797844 17:76358357-76358379 AAGTTTGCTTTTTAGGAGCTGGG + Intronic
1152972719 18:179746-179768 AATTTTTTTTTTTATTTGCTGGG - Intronic
1153459894 18:5322054-5322076 AAGTTTTATTTTTAGAGACAGGG + Intergenic
1154128896 18:11718110-11718132 AACTTTTTTTTTAAACTGCTAGG - Intronic
1154208860 18:12361749-12361771 ATCTTTTATTTTTAGATACTTGG - Intronic
1155305520 18:24474378-24474400 AAGTTTTCTTTTTAACTGTAGGG - Intronic
1156271230 18:35534550-35534572 AACTTTTATTCTTTGCTGGTAGG + Intergenic
1156321682 18:36031344-36031366 AAGTTTTAGTACTGGCTGCTAGG + Intronic
1156641415 18:39105029-39105051 AATTTTTGTTTTCAACTGCTAGG + Intergenic
1157375074 18:47155681-47155703 TAATTTTATTTTAAGCTCCTTGG - Intronic
1157400763 18:47384561-47384583 AACTTTTATTTTTAGATTCAGGG + Intergenic
1157861138 18:51141488-51141510 ACTTCTTAATTTTAGCTGCTGGG + Intergenic
1157980180 18:52370704-52370726 AACTTTTATTTTAAGTTGCAGGG - Intronic
1158075675 18:53525874-53525896 AAGTTTTATTTTCAGCTATAAGG + Intronic
1158762358 18:60404823-60404845 GACTTTTATTTATAGATGCTAGG - Intergenic
1159159519 18:64625169-64625191 AACTTTCATTTATGGCTGCTTGG - Intergenic
1160509253 18:79444089-79444111 AGGTTTTATTTCTACCTGTTTGG - Intronic
1163521124 19:17792683-17792705 CAGTGTTCTTTTCAGCTGCTTGG - Intergenic
1163901208 19:20101522-20101544 AACTTTTATTTTTATCTTCATGG + Intronic
1164273486 19:23695281-23695303 TACTTTTAATTTTAGCTACTTGG + Intergenic
1165981421 19:39727525-39727547 CATTTTTATTTGTAGCTACTCGG - Intergenic
1166034807 19:40160364-40160386 AAGTTTTATTTTTAGATACAGGG - Intergenic
1166286242 19:41831040-41831062 ATGTCTTCTTTTTAGCAGCTAGG - Intergenic
927600946 2:24440236-24440258 AGGTTTTATGTTTATCTGCTTGG - Intergenic
929632749 2:43481857-43481879 AAGGTTTATTTTTGACTTCTTGG - Intronic
929675768 2:43926861-43926883 AACATTTAGTTTTAGGTGCTAGG - Intronic
929695162 2:44108348-44108370 ATGTTTTATTATTATTTGCTTGG + Intergenic
930271879 2:49266879-49266901 AATTTTTATTTTAAGCATCTAGG - Intergenic
930378523 2:50597698-50597720 AGGTTTTCTTGTTTGCTGCTCGG + Intronic
930467327 2:51771412-51771434 AAGCTTTATGTTGTGCTGCTGGG + Intergenic
931158638 2:59664255-59664277 AATTTTTATTTTTAGGTTCCTGG - Intergenic
931549859 2:63431029-63431051 TTGTTTTGTTTTCAGCTGCTTGG + Intronic
931609730 2:64085915-64085937 TACTTTTATTTTTAACTCCTTGG - Intergenic
931872402 2:66475578-66475600 CAGTCTTTGTTTTAGCTGCTAGG - Intronic
932287230 2:70546319-70546341 AACTTTTATTTTTAGATTCAGGG + Intronic
932792983 2:74672087-74672109 CAGTTTTATTCTTACCTGCAGGG + Intronic
935321655 2:101895349-101895371 AAGTTTTTTTTTTTCCTACTTGG + Intergenic
936558645 2:113517602-113517624 GAGGTTTATTTTTAATTGCTAGG - Intergenic
936791180 2:116154668-116154690 ATGATTTAGTTTTAGCTTCTGGG - Intergenic
936808490 2:116366991-116367013 AAGTTTTTTTTTCAACTGCATGG + Intergenic
937760645 2:125598512-125598534 TAGTTCTATTTTTAGCTCTTTGG + Intergenic
937827769 2:126386870-126386892 AAGTTTTGCTTTTTGCTGTTGGG + Intergenic
937888654 2:126917859-126917881 AAGCTTTATTTTTATCTTCTTGG - Intergenic
938784302 2:134611079-134611101 AAATTTTATTTTTATTTGTTTGG - Intronic
939225857 2:139363349-139363371 ATGTTTTATTCTTTTCTGCTTGG - Intergenic
939410220 2:141815223-141815245 TAGATTGATTTTTAGCTGGTAGG + Intronic
940829196 2:158449164-158449186 CAGTTGTATTTTTATATGCTAGG - Intronic
940959735 2:159771561-159771583 GGCTTTTATTTTTATCTGCTTGG + Exonic
941228779 2:162882855-162882877 AAGTTACATTTATAGCTACTGGG + Intergenic
941542710 2:166806455-166806477 ATGTGTTATTTTAAGCTACTAGG - Intergenic
941787361 2:169512780-169512802 AGGTTTTATATTTTTCTGCTTGG + Intronic
941964891 2:171291281-171291303 AATTTTTATTTTTAGAAGCAGGG - Intergenic
942080440 2:172395230-172395252 GAGCTTTATTTTCATCTGCTTGG - Intergenic
942424966 2:175849853-175849875 AAGTTTTATCTCTAGCTTGTTGG - Intergenic
942654626 2:178202525-178202547 AAGATTTCTTTTTATCTGCCGGG + Intronic
943118755 2:183708136-183708158 GAGATTTATTTTTACTTGCTTGG - Intergenic
943852386 2:192740942-192740964 AAGTTTTATTCTCAGAAGCTGGG + Intergenic
944663997 2:201944325-201944347 TAGTTTTATATTTAGTTTCTTGG - Intergenic
944821603 2:203438191-203438213 CAGTTTCATTTATAGCTACTGGG - Exonic
946802839 2:223438600-223438622 AACTTTTATTTTTAGATACAGGG + Intergenic
947574933 2:231265674-231265696 AAGTTTTATTTCAAGTTTCTGGG - Intronic
948260345 2:236599841-236599863 AATTTTTATTTTTAAGTGCCGGG + Intergenic
948444365 2:238020670-238020692 AAATTTGAATTTTGGCTGCTGGG - Intronic
1169491317 20:6073587-6073609 AAGATTTATTTTTGGGGGCTGGG - Intergenic
1169814712 20:9644453-9644475 AACTTTTATCTTTTGCAGCTGGG - Intronic
1173432314 20:42999581-42999603 AAGTTTTTTTTTTAGAGACTGGG - Intronic
1174197535 20:48784315-48784337 AAGTGTTATTTTTTACTGTTGGG - Intronic
1176379173 21:6103222-6103244 GAGTTTCATTTTTAACTGCATGG + Intergenic
1177293299 21:19143110-19143132 AAATTTTACTTTTAACTTCTTGG - Intergenic
1177553747 21:22661493-22661515 GACTTTTATTTTTAGCTTTTGGG + Intergenic
1177707221 21:24722325-24722347 AAGATTTATCTTTAACTCCTAGG + Intergenic
1179057408 21:37948834-37948856 ATGTTCTACTTTTAGGTGCTTGG + Intergenic
1179058381 21:37956618-37956640 AAGTTTTATTTTTAAGTTCAGGG - Intronic
1179278893 21:39917076-39917098 AATTTTTATTTTAAGCTCCAGGG - Intronic
1179744300 21:43435015-43435037 GAGTTTCATTTTTAACTGCATGG - Intergenic
1181806591 22:25378430-25378452 AATTTTTATTTTTAGTAGATGGG + Intronic
1182033265 22:27176818-27176840 AACTTTTATTTTAAGATACTTGG - Intergenic
1182861900 22:33567613-33567635 AATTTTTAATTTTAGATTCTGGG + Intronic
949832401 3:8229864-8229886 TAGTTTTATTTTGATCTGCTTGG + Intergenic
951966752 3:28395355-28395377 TAGTTTTATTTTTAACTTTTTGG - Intronic
952054743 3:29431040-29431062 AAGTATTCTGTTTAGCTTCTTGG - Intronic
954960441 3:54559595-54559617 AACTTTTATTTTTAACTTCAGGG + Intronic
956059995 3:65339741-65339763 AGGTTTTATTTTTCTCAGCTGGG + Intergenic
956863428 3:73346951-73346973 AAGTTTAAATTTTTGCTGCGGGG + Intergenic
956877604 3:73479202-73479224 CAGTTTTATTTGAAGTTGCTGGG - Intronic
957181385 3:76882610-76882632 TAATTTTATTTTTAGTTACTTGG - Intronic
957468784 3:80631287-80631309 AAGTTTTATTTTTCCCTTCTAGG - Intergenic
958776683 3:98492640-98492662 AAGTTCTATTTTTAATTGTTTGG - Intergenic
958900198 3:99876558-99876580 ACTTTTTATTTTTGGTTGCTGGG + Intronic
959111660 3:102130087-102130109 ACTTTTTATTTTTAGCTCTTGGG - Intronic
959297133 3:104550709-104550731 AATATTTATTTTTAGTTTCTGGG + Intergenic
959445773 3:106437327-106437349 AAGTTTTATTTTTAAATGACAGG + Intergenic
959591094 3:108082318-108082340 AAGATTTATTTTTATCTGTATGG - Intronic
960235206 3:115274001-115274023 AATTTTTATTTTTAAGTTCTGGG + Intergenic
960286326 3:115833306-115833328 CAGTCTTATTTTTAGTGGCTGGG + Intronic
960353412 3:116621339-116621361 GAGTTTTTTTTTTAACTGCCAGG - Intronic
961190076 3:124952756-124952778 AATTTCTATTATTAGCTTCTTGG - Intronic
963487000 3:145947505-145947527 AACTTTTATTTTAAGTTCCTGGG + Intergenic
963750588 3:149175377-149175399 AAGTTTTAATTTCTGCTCCTGGG - Intronic
963867736 3:150380650-150380672 TAGTCTTATTTTTAGTTACTGGG - Intergenic
964473664 3:157079520-157079542 AATTTTTATTTTTATTTGTTCGG - Intergenic
964994219 3:162854883-162854905 TAGTTTTATTATTATGTGCTTGG - Intergenic
965166538 3:165200548-165200570 AACTTTTATTTTTAGTTCCAGGG + Intergenic
965191813 3:165540297-165540319 GAGTGTTTTTTTAAGCTGCTAGG + Intergenic
966052781 3:175641455-175641477 AAGTTTTATCTTCAGAGGCTGGG + Intronic
966828304 3:183984259-183984281 AAGATTGATTTTTAGATGCAAGG - Intronic
969849988 4:9948482-9948504 AAGCTTGACTTATAGCTGCTGGG + Intronic
970082678 4:12305620-12305642 ACGTTTCATTTTGTGCTGCTGGG + Intergenic
970124963 4:12798960-12798982 AATTATTACTTTTAGCTACTGGG - Intergenic
970375136 4:15449634-15449656 TAGTTTTATTTTTAGCTCTTTGG - Intergenic
971594570 4:28512446-28512468 AAGTCTTTTTTTCAGCTACTCGG - Intergenic
971685040 4:29754629-29754651 CAGTTTTTTTTTTTGTTGCTGGG - Intergenic
971884032 4:32419955-32419977 TTGTTTTTTTTTTAGCTTCTTGG + Intergenic
972092132 4:35300788-35300810 GACTTTTATTTTTAGATTCTAGG + Intergenic
972330477 4:38059725-38059747 AATTTTTATTTTTAGTTCCAGGG + Intronic
973023176 4:45230048-45230070 AAGTTTTATTTTAAGCCAATGGG + Intergenic
973089141 4:46110375-46110397 AAACTTTATTTTGAGCTGATGGG + Intronic
973728051 4:53795617-53795639 AATTTTTATTTTAAGTTGCAGGG - Intronic
974144845 4:57934464-57934486 AACTGTTATTTTTAGCTTCGTGG + Intergenic
974541365 4:63241632-63241654 AATTTTTATTTATTGCTGGTAGG - Intergenic
974568702 4:63613629-63613651 AACTTTTATTTTTAGTTCCAGGG - Intergenic
974656058 4:64824019-64824041 AAATTTTATTTTAAGTTCCTTGG - Intergenic
974668678 4:64999933-64999955 AACTTTTATTTTAAGTTACTGGG - Intergenic
974880521 4:67751666-67751688 ATATTTTATTTATAGCTTCTAGG + Intronic
975231356 4:71937472-71937494 CACTTTAATTTTTTGCTGCTCGG + Intergenic
975233276 4:71960025-71960047 AAGTATTATTTTTATTTGTTTGG + Intergenic
975602327 4:76114542-76114564 AAGTCTTATTTTTGCCTCCTAGG - Intergenic
975972519 4:80058567-80058589 AATATTTATTTTCAGTTGCTTGG - Intronic
976358538 4:84149689-84149711 AATTTTTAATTTTATTTGCTGGG - Intergenic
976473575 4:85456929-85456951 ATGTAGTATTTTTATCTGCTTGG + Intergenic
976673192 4:87676423-87676445 TAGTTTTATTTTTAGTTCCTTGG - Intergenic
976702640 4:87987934-87987956 AAGATTTCTTTTTAGCTTTTTGG + Intergenic
976844350 4:89470874-89470896 CAGTTTTAAGTTTAGTTGCTGGG + Intergenic
976868846 4:89765680-89765702 AAGATTTATTTTTATCTGGGTGG + Intronic
977034800 4:91935954-91935976 GGGTTTTATGTTTAGCTGATTGG + Intergenic
977138169 4:93332792-93332814 GAGTTTTAGTTTTAGCCCCTAGG - Intronic
977582143 4:98737055-98737077 AATTTTTATTTTTAAATTCTGGG + Intergenic
978940134 4:114426374-114426396 AATTTTTTTTTTTGGTTGCTAGG + Intergenic
979094345 4:116527268-116527290 TAGGTTTTTTTTTAGATGCTAGG + Intergenic
979181256 4:117730483-117730505 ACCTTTTATCTTGAGCTGCTAGG - Intergenic
979181446 4:117734051-117734073 AAGCTTTATTTTTAGCCATTTGG + Intergenic
979297180 4:119046876-119046898 AAGTTTTACTTTCTGCTTCTAGG - Intronic
979545484 4:121935205-121935227 AAATTTTATTTTTAATTCCTTGG + Intronic
980282733 4:130741542-130741564 AATTTTTATTTTTAGATACATGG + Intergenic
980603335 4:135055734-135055756 AAATTTTTTTTTTAGATGCTGGG - Intergenic
980807668 4:137834367-137834389 AATTTTTTTTTTTAGTTGCTAGG - Intergenic
981018383 4:139999611-139999633 AACATTTATTTTTAAATGCTGGG + Intronic
981251957 4:142613719-142613741 AAGATTAATATTTAGATGCTGGG + Intronic
981629181 4:146798390-146798412 AAGTTTTACTTTTCCCTGGTTGG - Intronic
981860010 4:149343317-149343339 AAATTTTTTTTTTGGCTTCTTGG + Intergenic
982244455 4:153336390-153336412 AACTTTTATTTTGACCTGTTGGG - Exonic
983312091 4:166077627-166077649 AACTTTTATTTTAAACTGATGGG - Intronic
983692820 4:170493055-170493077 AAGTTATATTTTTATCTTTTGGG + Intergenic
983794525 4:171844519-171844541 AAGTTTTATTTTCAGATGTGAGG + Intronic
984177380 4:176436349-176436371 AAGCATTATTTCTAGCAGCTGGG + Intergenic
984337264 4:178408486-178408508 AACTTTTATTTATTGCTGGTGGG + Intergenic
985310604 4:188594011-188594033 GGGTTTTGTTTTTAGCTGCACGG - Intergenic
985360122 4:189166029-189166051 AAATTTTAGTTTTAACTACTAGG + Intergenic
985396347 4:189548727-189548749 ATGTTCTATTTTTAGATACTAGG + Intergenic
986219361 5:5753619-5753641 AAGTTTTATTTTTTGTTTATAGG + Intergenic
986896807 5:12381165-12381187 AAGTTTTCTTTTTCGTTGTTGGG + Intergenic
987517417 5:18930742-18930764 AAATTTTATTTTAAGCTCCAGGG - Intergenic
987780715 5:22430800-22430822 AGTTTCTAATTTTAGCTGCTTGG - Intronic
987900617 5:24006704-24006726 AAGTTATATTTTGAGCAGGTAGG + Intronic
988256479 5:28826428-28826450 ATATTTTATTTCTAGCTTCTTGG + Intergenic
988264552 5:28930600-28930622 AATTCTCATTTTCAGCTGCTGGG - Intergenic
988449430 5:31326018-31326040 AGGTTTTTTTTTTAATTGCTAGG + Exonic
988481652 5:31636469-31636491 CAGTTTTAGTTTCAGCTGCCTGG + Intergenic
989605645 5:43242129-43242151 AAGTTTCATTTGTAGGTGTTAGG + Intronic
990330141 5:54717625-54717647 TAGTTTTATTTTTAACTTTTTGG - Intergenic
991115148 5:62946369-62946391 AAGCTTTATTTTCAGCTGATAGG + Intergenic
991207171 5:64062491-64062513 TAGTTTTATTTTGACCTGATCGG - Intergenic
991508154 5:67346680-67346702 AAGTTTTATATATGTCTGCTAGG - Intergenic
992537899 5:77729948-77729970 AAATATTATTTTCAGTTGCTTGG + Intronic
993330232 5:86590646-86590668 ACATTTTATTTTTAGAAGCTAGG + Intergenic
993535795 5:89084661-89084683 TAGTTATAGTTATAGCTGCTAGG - Intergenic
993879124 5:93342410-93342432 AATTTTTATTTTTAGATTCAGGG - Intergenic
994232737 5:97327219-97327241 TATTTTTATTTTTAGTTTCTGGG + Intergenic
994464833 5:100112996-100113018 TATTTTTATTTTTTGCTGGTAGG - Intergenic
994765128 5:103905760-103905782 GAGTTTTATTTTTAGCTTTTGGG - Intergenic
996045261 5:118864867-118864889 AACTTTTCTTTTTAATTGCTAGG + Intronic
996694325 5:126377000-126377022 GAGTTTTATTCTTTCCTGCTGGG - Intronic
996784919 5:127228329-127228351 CAATTTAATTTTTAGCTGCGTGG + Intergenic
996855453 5:128000792-128000814 GATTTTTTTTTTTAGCTGCTAGG + Intergenic
996969751 5:129351117-129351139 AAGTTTGATTTTTAGGTATTTGG + Intergenic
997759353 5:136429964-136429986 ATGTCTTATTTGTAGCAGCTAGG - Intergenic
998668708 5:144329244-144329266 AACTTTAATTTTTATTTGCTTGG + Intronic
998715335 5:144877294-144877316 TACTTTTATTTTTAACTTCTGGG - Intergenic
999062058 5:148646612-148646634 TAGTTTTATTTTTTGCTCCAGGG - Intronic
999397360 5:151238550-151238572 AAGTTTTATTTTTAGCTGCTGGG - Intronic
1000220105 5:159207495-159207517 AATTTTTTTTTTTAACTGGTTGG - Intronic
1000341973 5:160284871-160284893 AACTTTTTTTTTTAATTGCTTGG + Intronic
1000769708 5:165337422-165337444 TAATTTTATTATTAGCTCCTGGG + Intergenic
1000804995 5:165779164-165779186 AAGGTTTATTTTTAGCTTCTTGG + Intergenic
1001206226 5:169765771-169765793 AATGTTTATTTTCAGCTGGTGGG + Intronic
1002811043 6:629020-629042 TAGTTTCATTTTCACCTGCTGGG - Intronic
1002929383 6:1622896-1622918 AAGTTTTATTTTATTTTGCTTGG + Intergenic
1003500816 6:6701315-6701337 AAGATTTAGATTTAGCTGCCTGG + Intergenic
1003543000 6:7034465-7034487 AATTTTTATTTTTAGATGGGTGG - Intergenic
1004243965 6:13954566-13954588 AAATTTTTTTTTTAGCTCTTTGG + Intronic
1004275115 6:14229321-14229343 AGGTTTTATCTTTGGCTGGTAGG + Intergenic
1004413314 6:15401450-15401472 AACATTTATTTTTAAATGCTGGG - Intronic
1004464277 6:15869721-15869743 AAATTTTATGTTCAGCTGCTTGG - Intergenic
1005061030 6:21777285-21777307 ATGTATTATCTTCAGCTGCTGGG + Intergenic
1005114687 6:22322559-22322581 CAGTTTTATTGTTTGCTGCATGG + Intergenic
1005218333 6:23557469-23557491 TTGTTTTATTTGTAGCTGCTGGG - Intergenic
1005430371 6:25750469-25750491 CAGTTTTATCTTTAACTGTTGGG - Intergenic
1005766461 6:29016110-29016132 ATTTTTTACTATTAGCTGCTTGG + Intergenic
1007506654 6:42340759-42340781 GAGTTTTCTTTTTTGCCGCTGGG - Intronic
1007668301 6:43529957-43529979 AAGTTTTATCTTTCACAGCTGGG + Intronic
1008851295 6:56025724-56025746 AAATGTTATCTTTATCTGCTTGG + Intergenic
1008853670 6:56055101-56055123 ACGTTTTGTTTCTAGCTGCGAGG - Intergenic
1009963555 6:70553727-70553749 AAATTTTATTTTTAATTGTTTGG - Intronic
1010001265 6:70952324-70952346 AAGTTTTTTTTTTTCTTGCTTGG + Intronic
1010292986 6:74161205-74161227 AATTTTTATTTTTAGATTCATGG - Intergenic
1011378244 6:86714255-86714277 TAGTTCTATTTTTAGCTTTTTGG - Intergenic
1011912688 6:92462652-92462674 AATTTATATTTTTGGCTACTTGG - Intergenic
1011946029 6:92904437-92904459 AACTTTTATTTTAAGCTCCAAGG - Intergenic
1012096748 6:94971981-94972003 AACTTTTATTTTTAACTCATGGG + Intergenic
1012276018 6:97276668-97276690 CAGTTTTATTTTTTTCTGCCTGG + Intronic
1012832658 6:104225113-104225135 AAAATGTATTTTTAGCTGCTGGG - Intergenic
1014471705 6:121823351-121823373 GAGTTGTTTTCTTAGCTGCTGGG - Intergenic
1014628411 6:123759640-123759662 GAGTTTTACTTTGACCTGCTTGG + Intergenic
1015054855 6:128888191-128888213 TAGTTTTATTTCTATCTGCTTGG - Intronic
1015650179 6:135448468-135448490 AATTCTTATTTTAAGCTTCTGGG - Exonic
1015857807 6:137644112-137644134 AATTTTTATTTTAAGTTCCTGGG - Intergenic
1015960927 6:138648825-138648847 AATTTTTTTTTTTAACTTCTGGG + Intronic
1015986808 6:138892869-138892891 AAGTTTTATGTTTACCTGGCTGG + Intronic
1016057246 6:139591575-139591597 ATTTTGTATTTTTAGATGCTAGG + Intergenic
1016459680 6:144269245-144269267 TTGTTTTATGTTAAGCTGCTGGG + Intergenic
1017963415 6:159242478-159242500 AATTTTTATTTTTAAGTTCTGGG - Intronic
1020461216 7:8432587-8432609 AAGAGTTATTTTTAGCTGGAAGG + Intergenic
1020910800 7:14128038-14128060 AACTTTTATTTTAAGCTCCGGGG + Intergenic
1021750720 7:23796353-23796375 AAGTTTTTTTTTTTGTTTCTGGG + Intronic
1022271930 7:28816848-28816870 AAGGTTTATTTGTGGCTGCCAGG - Intronic
1022884323 7:34626496-34626518 AAGAATTAATTTGAGCTGCTTGG - Intergenic
1023556087 7:41424407-41424429 AAGGTTTAATTTGAGCTGCTTGG + Intergenic
1024099458 7:46015577-46015599 AAGCTGTTTTTTTAGCTCCTTGG + Intergenic
1024122562 7:46260096-46260118 TAGCTTTTTTTTTAGTTGCTTGG + Intergenic
1024433086 7:49313307-49313329 AACTTTTATTTTAAGCTCATAGG - Intergenic
1024567775 7:50696715-50696737 AAGTTTTATTTTTAGAAGTTTGG - Intronic
1025170962 7:56756195-56756217 AATTTTTATTTTTATTTTCTTGG + Intergenic
1025700918 7:63819503-63819525 AATTTTTATTTTTATTTTCTTGG - Intergenic
1026329564 7:69339857-69339879 AACTTTTATTTTAAGTTCCTGGG - Intergenic
1028038935 7:86022457-86022479 TAGTTTTATTTTTAGTTTTTTGG + Intergenic
1028324144 7:89501487-89501509 AATTTTGATTTTTAGATGTTAGG - Intergenic
1028329219 7:89567835-89567857 CAGCTTTTTTTTTAGCTGATAGG - Intergenic
1028474111 7:91235025-91235047 AATTTTTATTTTTAGTTCCAGGG - Intergenic
1028778874 7:94712620-94712642 TAGTTTTAGATTTTGCTGCTTGG - Intergenic
1029452792 7:100651253-100651275 AAATTTTTTTTTTAGATGCTGGG + Intronic
1029958656 7:104667036-104667058 AAGTTTTATTTTTAGCTTTTTGG + Intronic
1030440031 7:109577796-109577818 ATGTTTTATATTTAACTTCTGGG + Intergenic
1030760120 7:113340138-113340160 AAGAATTATCTTTAGCAGCTTGG + Intergenic
1031623417 7:123964471-123964493 TAATTTTATTTTTCTCTGCTAGG + Intronic
1031635182 7:124093663-124093685 AAGATTTAATTTTGTCTGCTTGG - Intergenic
1031747211 7:125515187-125515209 AACTTTTATTTTTTTCTTCTAGG - Intergenic
1032731430 7:134646993-134647015 ATGTTTTATTTTTGGGTGCGGGG + Intronic
1032848193 7:135769760-135769782 AACTTTTATTTTTAGATTCAGGG - Intergenic
1033232273 7:139609368-139609390 AAGTTTTATGTGATGCTGCTGGG + Intronic
1033823167 7:145158343-145158365 AATTTACATTTTTAGCAGCTAGG + Intergenic
1033848588 7:145465443-145465465 TAGTTCTATTTTTAGCTTTTTGG + Intergenic
1035917940 8:3645308-3645330 AGGTTTTAATTGCAGCTGCTGGG - Intronic
1037352207 8:17972605-17972627 GAGTTTTATCTTTAGATGCCAGG - Exonic
1038098387 8:24342453-24342475 AATTTTTATTTTCAGCTCCAGGG - Intronic
1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG + Intergenic
1038678243 8:29643226-29643248 AACTTTTATTTTAAGTTCCTGGG + Intergenic
1039132675 8:34285228-34285250 ATGTGTTGTTTTTAGCTGTTAGG + Intergenic
1039327837 8:36504347-36504369 AAGTAATATTTTTACCTGTTTGG + Intergenic
1039356976 8:36829832-36829854 AACTTTTATTTCTAGGTACTTGG + Intronic
1039700298 8:39955075-39955097 CAGTTATATTTTTAGGTACTAGG + Intronic
1040674804 8:49735681-49735703 CAGTTTTATCTATGGCTGCTAGG + Intergenic
1042420711 8:68585545-68585567 AAGTATTATTTTAAGCCACTAGG - Intronic
1043267993 8:78290453-78290475 AATTTGTATTTTTAGATGCTAGG - Intergenic
1043881965 8:85554253-85554275 TAGTTTTATTGTTTGGTGCTAGG + Intergenic
1044176494 8:89130577-89130599 AACTGTTTTTTTTAGCTTCTAGG - Intergenic
1044590834 8:93913237-93913259 CAGGTTTATTTTAAGCTTCTTGG + Intronic
1045090099 8:98733181-98733203 CTGTTTTATCTTTAGCTCCTAGG - Intronic
1046401754 8:113713601-113713623 AAGTGATAGTTTCAGCTGCTGGG + Intergenic
1046457803 8:114490278-114490300 AACTTTTATTTTTAGATTCAAGG - Intergenic
1046667878 8:117024812-117024834 AAGTTTTATTTTAAGCTCCAGGG + Intronic
1046948101 8:119993589-119993611 AAATTTCATTTTTTGCTCCTTGG - Intronic
1047177977 8:122559344-122559366 AATTTTTATTTTTAGATCCAGGG - Intergenic
1047638161 8:126789576-126789598 AATTTTTATTTTTAAGTTCTGGG + Intergenic
1047886663 8:129258530-129258552 TAGTTTTATTTTTAGTTCTTTGG - Intergenic
1049894202 9:98569-98591 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1051318603 9:15873356-15873378 AAGTTATATTTGAAGTTGCTTGG + Intronic
1051968306 9:22856523-22856545 GTGTTTTATGTTTAGATGCTGGG - Intergenic
1052088419 9:24296037-24296059 ATTTTTTCTTTTAAGCTGCTTGG + Intergenic
1052768658 9:32667600-32667622 ATGTTTTATTTGTAGCAACTTGG + Intergenic
1053253972 9:36599368-36599390 AAGTTTCATTTTTATCTTATTGG + Intronic
1053735429 9:41098658-41098680 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1054692949 9:68332743-68332765 GAGGTTTATTTTTAATTGCTAGG - Intronic
1055042911 9:71894524-71894546 AAGTTTTATCTTTAGCACTTGGG + Intronic
1055879636 9:80984694-80984716 AAGTCTTATTCATTGCTGCTGGG - Intergenic
1056410075 9:86317073-86317095 AAGGATTTTTTTTATCTGCTGGG + Intronic
1057997930 9:99836752-99836774 TAGTTTTAGTTTTAGCTTTTTGG + Intronic
1058287316 9:103194904-103194926 TAGTTTTATTAGTTGCTGCTAGG - Intergenic
1058502823 9:105638684-105638706 AGATTTTTTTTTTATCTGCTTGG + Exonic
1059131236 9:111751877-111751899 AAATTTTCTTTTTATCTCCTAGG - Intronic
1060273356 9:122163771-122163793 AAGTTTTATTTCCTGATGCTTGG - Intronic
1185650651 X:1645696-1645718 AAGTTTTCTTTAAAGCTGATAGG - Intergenic
1185715963 X:2342413-2342435 TAGTTCTATTTCTAGCTCCTGGG + Intronic
1186233840 X:7485555-7485577 TAGTGTTGTTTTCAGCTGCTTGG - Intergenic
1187756442 X:22532324-22532346 AACTTTTATTTTTAGTTTCAGGG - Intergenic
1188326281 X:28806200-28806222 AAGCTTTATTTTTAGTTGGCAGG + Intronic
1189872794 X:45402115-45402137 AAGTTTTATTTTAAGTTCCAGGG + Intergenic
1190567886 X:51749646-51749668 AAGTTTCAATATTATCTGCTTGG - Intergenic
1191682151 X:63852109-63852131 AAAGTTTATTTTTAGCAGATGGG + Intergenic
1191989927 X:67024175-67024197 AAATTTTATTTTAAGCTCATGGG + Intergenic
1192521901 X:71809616-71809638 ATGTCTTATTTTTTTCTGCTAGG + Intergenic
1193125201 X:77863547-77863569 TAGTTCTATTTTTAGTTTCTTGG - Intronic
1193756056 X:85409679-85409701 AAGTTTTTTTTTTAGAAGATAGG + Intergenic
1193873263 X:86828478-86828500 AAGGGGTATTTTTAGCAGCTTGG - Intronic
1194190267 X:90826442-90826464 AAGATATATTTTGATCTGCTTGG + Intergenic
1195011585 X:100737382-100737404 AAGTTTTAATTCTGGCTGCCAGG + Intergenic
1195855507 X:109328025-109328047 AAGCTTTTTTATTTGCTGCTGGG + Intergenic
1196289462 X:113922296-113922318 ATGTTGTATTTTTAGTTGATTGG + Intergenic
1196357604 X:114811941-114811963 AATTTTTATTTTTAAGTTCTGGG + Intronic
1197467894 X:126828725-126828747 AAGTTTTATTTCTTTATGCTTGG + Intergenic
1197846872 X:130812437-130812459 AAAGTTTATTCTTAGTTGCTAGG - Intronic
1198605103 X:138329024-138329046 ATGTTTTGTTTTTAGCTCATTGG + Intergenic
1198874653 X:141210610-141210632 AACTTTTATTTTAAGTTCCTGGG + Intergenic
1200536862 Y:4408542-4408564 AAGATATATTTTGATCTGCTTGG + Intergenic
1201977166 Y:19864332-19864354 AAGTTTTATATTTTTCTACTGGG + Intergenic
1202347037 Y:23942279-23942301 AAGTTGTATTTTTTTGTGCTGGG - Intergenic
1202523734 Y:25727811-25727833 AAGTTGTATTTTTTTGTGCTGGG + Intergenic