ID: 999406404

View in Genome Browser
Species Human (GRCh38)
Location 5:151310835-151310857
Sequence ACCTAAACAAGACTACCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999406404_999406406 15 Left 999406404 5:151310835-151310857 CCTTAAGGTAGTCTTGTTTAGGT No data
Right 999406406 5:151310873-151310895 TTCTATAAACTTCTTGTACTTGG No data
999406404_999406405 -10 Left 999406404 5:151310835-151310857 CCTTAAGGTAGTCTTGTTTAGGT No data
Right 999406405 5:151310848-151310870 TTGTTTAGGTTAAATCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999406404 Original CRISPR ACCTAAACAAGACTACCTTA AGG (reversed) Intergenic