ID: 999409290

View in Genome Browser
Species Human (GRCh38)
Location 5:151336344-151336366
Sequence GGTAGCGAGGAGGATATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999409290_999409300 24 Left 999409290 5:151336344-151336366 CCATCTATATCCTCCTCGCTACC 0: 1
1: 0
2: 0
3: 13
4: 163
Right 999409300 5:151336391-151336413 CTGCTTTTTAATTTAGTGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 273
999409290_999409299 20 Left 999409290 5:151336344-151336366 CCATCTATATCCTCCTCGCTACC 0: 1
1: 0
2: 0
3: 13
4: 163
Right 999409299 5:151336387-151336409 AGATCTGCTTTTTAATTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999409290 Original CRISPR GGTAGCGAGGAGGATATAGA TGG (reversed) Intronic
902689776 1:18103381-18103403 GGGAGAGAGGAGGATAGAGAGGG + Intergenic
902727179 1:18344926-18344948 GGAAGCGAGGAGGCTGCAGAGGG + Intronic
914445335 1:147745450-147745472 GATAGTGAGGAGGAAATACATGG + Intergenic
916321411 1:163509046-163509068 GGTATTGATTAGGATATAGAAGG - Intergenic
917810915 1:178657760-178657782 GTTAGGAAGGAGGAGATAGAAGG - Intergenic
919651495 1:200153791-200153813 GGTATGGAGGGGGAGATAGAGGG + Intronic
1067274282 10:44820309-44820331 AGTAGAGAGGATGATAGAGATGG - Intergenic
1068382746 10:56278738-56278760 GGTAGTGATGAGGGAATAGAGGG + Intergenic
1068960598 10:62863077-62863099 GGCAGCTAGTTGGATATAGAGGG - Intronic
1072108869 10:92298995-92299017 GGTGGGGAGGGGGATAGAGACGG + Intronic
1080199488 11:29651930-29651952 GGTAGCGAGTAGGATAGCTACGG + Intergenic
1084028105 11:66465623-66465645 GTTAGCGGGGTGGATATAGTAGG + Intronic
1084455583 11:69266291-69266313 GTTAGGGAGGAGGAGATAAAGGG + Intergenic
1085878258 11:80434652-80434674 GGTAGCATGGAGGATATTGTGGG - Intergenic
1086217279 11:84399191-84399213 GGTAGTGAAGAGGATACAGAGGG - Intronic
1091218673 11:133918422-133918444 GGGAGGGAGGAGGAGAGAGACGG + Intronic
1091830975 12:3551113-3551135 GGTGGCCAGGAGGATCTAGGGGG - Intronic
1094743125 12:33312177-33312199 GGGAGAGAGGGGGATAAAGATGG + Intergenic
1096393296 12:51246477-51246499 GGTAGGGACGAGGATATATGTGG - Intronic
1096556368 12:52406472-52406494 GGTAGCGAAGAGCAAAGAGAAGG + Intergenic
1102469361 12:113150821-113150843 GGGAGGGAGGAGGAAAAAGATGG - Intronic
1104870075 12:131988744-131988766 AGTAATGAGGAGGATAAAGAAGG - Intronic
1111587314 13:90298734-90298756 GGAAGTGAGGAGGGTATAGGTGG + Intergenic
1113524797 13:110966412-110966434 GGGAGCAAGAAGGATAAAGATGG + Intergenic
1115650658 14:35400593-35400615 GGTAGAGAGAAGAATAAAGATGG - Intergenic
1117936735 14:60915277-60915299 GGTAGAGAAGAGGTTTTAGATGG - Intronic
1122135910 14:99632935-99632957 GGGAGTGAGGAGGGGATAGAGGG + Intergenic
1129386526 15:75199314-75199336 GGGAGCAATGAGGAAATAGAGGG + Intronic
1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG + Intergenic
1131366515 15:91846345-91846367 GGGAGGGAGGAGGATAGAGAGGG - Intergenic
1132086453 15:98912111-98912133 GGTAGCCACCTGGATATAGAAGG - Intronic
1132437241 15:101818359-101818381 GTTAGCCAGGAGGAAATACATGG - Exonic
1134565436 16:15247812-15247834 GGCAGGGAGGAGGATGAAGAGGG - Intergenic
1134737060 16:16508886-16508908 GGCAGGGAGGAGGATGAAGAGGG + Intergenic
1134930460 16:18203278-18203300 GGCAGGGAGGAGGATGAAGAGGG - Intergenic
1137851736 16:51752418-51752440 GGTAGGGAGGAGGCTGTGGAGGG - Intergenic
1138939763 16:61776101-61776123 GATAGAGAGGAGGATAGAAAAGG + Intronic
1138991955 16:62401275-62401297 AGTATCTAGGAAGATATAGATGG + Intergenic
1139897536 16:70299455-70299477 GGTGGCGGGGAGGATAGGGATGG + Intronic
1142254373 16:89006815-89006837 GGGAGTGGGGAGGAGATAGAGGG - Intergenic
1143970554 17:10792222-10792244 GGGAGGGAGGAGGAAATAGGAGG - Intergenic
1146407475 17:32551788-32551810 GGAAGTGAGCAAGATATAGACGG - Intronic
1146418598 17:32661278-32661300 GGTAGGGAGGTGGGTTTAGAAGG - Intronic
1149402426 17:56312123-56312145 GGTAGCCCTCAGGATATAGAGGG - Intronic
1150199431 17:63339113-63339135 GGCAGTGAGGAGGATAAAGATGG + Intronic
1151430710 17:74060634-74060656 GGGAGGGAGAAGGATAGAGAGGG - Intergenic
1151583856 17:74996597-74996619 GGTAGAGAGAAGGAGTTAGAAGG - Intronic
1153826773 18:8882359-8882381 GGGAGCAAGGAGGATAAAGATGG - Intergenic
1155111376 18:22717914-22717936 GGTAGCTAGGAGACTATACAAGG - Intergenic
1156771430 18:40731760-40731782 GGTAGAGAGCAGAATATAAAAGG - Intergenic
1160056197 18:75483364-75483386 GCCAGCTAGGTGGATATAGAGGG + Intergenic
1161200832 19:3013874-3013896 AGTCGGGAGGAGGATAGAGAAGG - Intronic
1161243331 19:3235059-3235081 GGGAGCGAGGAGGAGAGAGGGGG - Intronic
1161405658 19:4089899-4089921 GGTGGCGGGGAGGACACAGAGGG + Intergenic
1162205650 19:9054320-9054342 GGAAGTGAGGAGGAGAAAGAAGG - Intergenic
1162268570 19:9595921-9595943 GGGAGCAAGGGGGATAAAGATGG - Intergenic
929489134 2:42380897-42380919 GGGAGCCAGGGGGATATAGTGGG + Intronic
930288255 2:49461651-49461673 GTTACCGAGGAGAATGTAGAGGG - Intergenic
931636791 2:64348058-64348080 GGAAGTGAGGAAGATAAAGAGGG + Intergenic
932610113 2:73192538-73192560 GGTAGCAAGGAGGAGAAGGAGGG - Intergenic
933390178 2:81657535-81657557 GGAAGCAAGGGGGATAAAGATGG - Intergenic
944616585 2:201466142-201466164 GGGAGGGAGGTGGATAAAGATGG - Intronic
945637230 2:212370461-212370483 GGTAGCTAGTTGGATATATAAGG + Intronic
947999453 2:234555783-234555805 GGTCGCGAGGAGGATGTGGCTGG + Intergenic
1175973923 20:62700875-62700897 GGCAGAGAGGAGGGTATAGGTGG + Intergenic
1177923297 21:27181963-27181985 GGTAGGTAGGTAGATATAGATGG - Intergenic
1179094179 21:38297058-38297080 GGGAGGGAGGAGGACAGAGAGGG + Intronic
1181904017 22:26178816-26178838 GGTAGTGATGAGGATGAAGAGGG + Intronic
1181986341 22:26802344-26802366 GGTAGGGAAGAGGATAGAGGAGG + Intergenic
1183017380 22:35000241-35000263 GGGAGCCAGGAAGATAAAGAAGG + Intergenic
1184834575 22:47013758-47013780 GGTAGAGAGGAGTAGAAAGACGG - Intronic
1185211722 22:49574311-49574333 GGAAGCCAGGAAGATATGGACGG + Intronic
950593072 3:13953038-13953060 GGAAATGAGGAGGATTTAGATGG + Intronic
950762375 3:15243430-15243452 GGGAGTCAGGAGCATATAGATGG + Intronic
950846836 3:16023188-16023210 GGGAGCAAGGGGGATAAAGATGG - Intergenic
951894024 3:27593940-27593962 GTTAGGCAGGAGGATAAAGAAGG + Intergenic
953054397 3:39376419-39376441 GGTAGAGAAGAGCATATAGAGGG + Intergenic
953583641 3:44179989-44180011 GGGAGGGGGGAGAATATAGAAGG - Intergenic
955874536 3:63476031-63476053 GGTAGGGAGGAAGAAAGAGAAGG + Intronic
958911490 3:99999247-99999269 TGTAGCAAGGAGGAAAAAGAGGG + Intronic
966452371 3:180076851-180076873 TGTAGCAGGGAGGATAGAGAGGG - Intergenic
967001102 3:185335823-185335845 GATAGTGAGGAGGATAAGGAGGG + Intronic
967028237 3:185582863-185582885 GGTAACTAGGGGGATATGGAGGG + Intronic
967620774 3:191630766-191630788 GATAGCAAGGAGGTGATAGAGGG + Intergenic
967861709 3:194157014-194157036 GGTAAAGAGGATGAGATAGATGG - Intergenic
973536661 4:51889642-51889664 GGTAGAGAGTAGAATAGAGATGG + Intronic
974020431 4:56687944-56687966 GGGAGGGAGGTGGATAGAGAGGG + Intergenic
974839928 4:67287757-67287779 GGTAGTGATCAGCATATAGATGG - Intergenic
974897813 4:67960170-67960192 GGTTGGGAGGAGGGCATAGATGG + Intronic
975049181 4:69838725-69838747 GATAGAGAGCAGGACATAGAAGG + Intronic
976206118 4:82625092-82625114 AGTTCCGAGGAGGAAATAGAAGG + Intergenic
977195590 4:94055125-94055147 GTTATCGAGGAGGATATGAAAGG + Intergenic
978313789 4:107414253-107414275 GGGAGCAAGGGGGATAAAGATGG + Intergenic
979438159 4:120719689-120719711 GGTAGTGAGGAAGTTATAAATGG + Intronic
983477780 4:168236539-168236561 GGTAGCAAGGATGAAAAAGAAGG - Intronic
986326911 5:6682426-6682448 GCTAGAGAGGTGGAGATAGAAGG + Intergenic
986981839 5:13457149-13457171 GGTACAGAGGAGGAGAAAGATGG - Intergenic
987078040 5:14402732-14402754 GGTGGTGATGAGGGTATAGATGG + Intronic
987799671 5:22677669-22677691 GGGAGAGAGCAGGATAAAGATGG + Intronic
989390028 5:40890449-40890471 GATAGGCAGGAGGATAGAGATGG + Intergenic
999409290 5:151336344-151336366 GGTAGCGAGGAGGATATAGATGG - Intronic
1002675697 5:180910772-180910794 TGTAGGGAGGAGGAATTAGAGGG - Intronic
1005165747 6:22918349-22918371 GGTAGAGAGGAGGACAGACAGGG - Intergenic
1005472484 6:26175337-26175359 GGGATCTAGGAGGAAATAGAAGG + Intergenic
1006109857 6:31737942-31737964 GGTGATGAGGAGGATAGAGAAGG - Intronic
1007122371 6:39393729-39393751 GGTTGGGAGGAGGATATATTTGG + Intronic
1010498604 6:76566971-76566993 GGTAGGGAGGAGGAAAAAGGTGG - Intergenic
1010506498 6:76666352-76666374 GGTAGGGAGGAAGATAAAGAAGG + Intergenic
1012661088 6:101893572-101893594 GGTAGCTAAGAAGATATAGCAGG - Intronic
1013212452 6:107999230-107999252 GAAAGCAAGGAGGATGTAGATGG - Intergenic
1013731436 6:113172819-113172841 GAGGGCGAGGAGGAGATAGAGGG + Intergenic
1015171028 6:130253711-130253733 GGTGGCAAGGAAGAAATAGAAGG - Intronic
1018233382 6:161698241-161698263 TGTAGCCAGAAGGATATAGTAGG + Intronic
1021926950 7:25543142-25543164 GCTGGCGAGGAGGGGATAGAAGG - Intergenic
1028333581 7:89625201-89625223 GGGAGCAAGGGGGATAAAGATGG + Intergenic
1028524335 7:91766914-91766936 GGTAGGGAGGAGGAAGTAGAGGG + Intronic
1034231130 7:149529403-149529425 GGTAGAGAGGAAGATAGAAAGGG - Intergenic
1034276691 7:149826863-149826885 GGTAGGGAGGAGGACATGGGAGG + Intergenic
1035280753 7:157776596-157776618 GGTAGGGAGGAGGAGAGAGGAGG - Intronic
1036105109 8:5830060-5830082 GGGAGCAAGAAGGATAAAGATGG - Intergenic
1039175458 8:34799252-34799274 GCTAGAGAGGAGGAGGTAGAGGG - Intergenic
1039186649 8:34924738-34924760 GGTAGTGAGAAGGATATATTGGG + Intergenic
1039298891 8:36187845-36187867 GGTAGAGAGGAGTCTTTAGATGG - Intergenic
1039455405 8:37702547-37702569 GGAAGGGAGGAGGAGAAAGAGGG + Intergenic
1040464969 8:47686019-47686041 GGAAGCAAGGAGGAGAGAGAAGG + Intronic
1044752577 8:95430538-95430560 GGCAGTGAAGAGGATGTAGAAGG + Intergenic
1047537618 8:125734022-125734044 GGAAGAGAGAAGGAAATAGAAGG + Intergenic
1049364957 8:142232663-142232685 GGTAGAGAGGAGGCTGTGGAAGG - Intronic
1050221410 9:3394636-3394658 GTTAGGGAGAAGGATATAGATGG - Intronic
1051100283 9:13513378-13513400 GGAAGCAAGGAGGCTATGGAGGG + Intergenic
1053398192 9:37794345-37794367 GGGAGGGAGGAGGAAAGAGAGGG + Intronic
1056151415 9:83793841-83793863 GGTAGCTAGGAGCAAATAGATGG - Intronic
1059205863 9:112464820-112464842 GGTAGAGGTGGGGATATAGAGGG - Intronic
1062690754 9:137841196-137841218 GGTGGCGTGGAGGATACGGAGGG - Intronic
1062690761 9:137841221-137841243 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062690778 9:137841273-137841295 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062690795 9:137841325-137841347 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062690803 9:137841350-137841372 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062690829 9:137841427-137841449 GGTGGCGTGGAGGATACGGAGGG - Intronic
1062690836 9:137841452-137841474 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062690889 9:137841604-137841626 GGTGGCGTGGAGGATACGGAGGG - Intronic
1062690896 9:137841629-137841651 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062690904 9:137841654-137841676 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062690948 9:137841781-137841803 GGTGGCGTGGAGGATACGGAGGG - Intronic
1062690955 9:137841806-137841828 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062690981 9:137841885-137841907 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062690989 9:137841910-137841932 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062690999 9:137841937-137841959 GGTGGCGTGGAGGATACGGAGGG - Intronic
1062691006 9:137841962-137841984 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062691016 9:137841989-137842011 GGTGGCGTGGAGGATACGGAGGG - Intronic
1062691065 9:137842144-137842166 GGTGGCGTGGAGGATACGGAGGG - Intronic
1062691073 9:137842170-137842192 GGTGGCGTGGAGGATACAGGAGG - Intronic
1062691079 9:137842195-137842217 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062691107 9:137842272-137842294 GGTGGCGTGGAGGATACGGAGGG - Intronic
1062691140 9:137842378-137842400 GGTGGTGTGGAGGATACAGAGGG - Intronic
1062691149 9:137842406-137842428 GGTGGCGTGGAGGATACGGAGGG - Intronic
1062691165 9:137842459-137842481 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062691173 9:137842484-137842506 GGTGGCGTGGAGGATATGGGGGG - Intronic
1062691193 9:137842536-137842558 GGTGGCGTGGATGATACAGAGGG - Intronic
1062691198 9:137842561-137842583 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062691206 9:137842586-137842608 GGTGGCGTGGAGGATATGGGGGG - Intronic
1062691226 9:137842638-137842660 GGTGGCGTGGATGATACAGAGGG - Intronic
1062691231 9:137842663-137842685 GGTGGCGTGGAGGATACAGGGGG - Intronic
1062691239 9:137842688-137842710 GGTGGCGTGGAGGATATGGGGGG - Intronic
1062691250 9:137842715-137842737 GGTGGCGTGGAGGATATGGAGGG - Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1189155798 X:38755713-38755735 GGCATCGAGGAGGATGTGGAAGG + Intergenic
1193853777 X:86573129-86573151 GGAAGAGAGGAGGAAAGAGAGGG + Intronic
1194604880 X:95966106-95966128 GATGGAAAGGAGGATATAGAGGG - Intergenic
1194740857 X:97572797-97572819 AGTAGAGAGGAGGGCATAGAAGG - Intronic
1196177465 X:112655576-112655598 GGTAGGGAGGAGAATAGAGGCGG - Intronic
1196377999 X:115056008-115056030 GGGAGAGAGGAGGAGTTAGAAGG + Intergenic
1196758169 X:119176269-119176291 GGTAGGGAGGAGGAAGTAGAAGG + Intergenic
1199138285 X:144279332-144279354 TGTAGAGAGGCGGATATTGATGG + Intergenic
1199637363 X:149826239-149826261 GGGAGCAAGGAGGATAAAGATGG + Intergenic
1200448888 Y:3299325-3299347 GGTAGCGTGAAGGATATGAATGG - Intergenic
1200763645 Y:7062541-7062563 GGGAGCAGGGAGGATAAAGATGG - Intronic