ID: 999412402

View in Genome Browser
Species Human (GRCh38)
Location 5:151363277-151363299
Sequence GTTCAGCAGCACCACACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999412402_999412405 25 Left 999412402 5:151363277-151363299 CCTACAGTGTGGTGCTGCTGAAC No data
Right 999412405 5:151363325-151363347 TGTCTGAGTTTTCAAACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999412402 Original CRISPR GTTCAGCAGCACCACACTGT AGG (reversed) Intergenic