ID: 999412402

View in Genome Browser
Species Human (GRCh38)
Location 5:151363277-151363299
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 8, 1: 25, 2: 30, 3: 63, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999412402_999412405 25 Left 999412402 5:151363277-151363299 CCTACAGTGTGGTGCTGCTGAAC 0: 8
1: 25
2: 30
3: 63
4: 258
Right 999412405 5:151363325-151363347 TGTCTGAGTTTTCAAACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999412402 Original CRISPR GTTCAGCAGCACCACACTGT AGG (reversed) Intergenic
900622346 1:3593217-3593239 GTTCAGCCGCTCCCCGCTGTGGG - Intronic
902569357 1:17336952-17336974 ATTAAGCAGCCCCACCCTGTAGG - Intronic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
905297632 1:36964184-36964206 GTACAGCAGCCCAACACAGTTGG - Intronic
905435927 1:37955115-37955137 GTTTAGCAGCACCAATCTGAGGG + Intergenic
906104739 1:43285030-43285052 TTTCACAAGCACCACACTGAGGG - Intronic
906538046 1:46562828-46562850 ATTCTGCAGAGCCACACTGTGGG + Exonic
906655026 1:47541897-47541919 TTTCAGCAGCACCCCACTTCTGG - Intergenic
909466173 1:75976616-75976638 GCACAGCAGCACCGCACTGAAGG + Intergenic
911418972 1:97615391-97615413 GGTCAGAATCACCCCACTGTTGG - Intronic
911764104 1:101653712-101653734 GTTTAGCAGCATAATACTGTAGG - Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915801430 1:158797070-158797092 GTTCAGTAGAACCTCACTGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
915969566 1:160344212-160344234 CTACAGCTGCCCCACACTGTGGG + Intronic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
917547207 1:175983564-175983586 TTTCAGCAGCACCCCACTTCTGG - Intronic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
918592010 1:186250540-186250562 TTTCAGCAGCAACACACTCCTGG + Intergenic
918621033 1:186606102-186606124 GTTCAGCAGCACCGGGCTCTAGG - Intergenic
918969559 1:191396971-191396993 TTTCAGCAGCACCCCGCTCTTGG - Intergenic
921146356 1:212361593-212361615 GCTCTGTATCACCACACTGTGGG - Exonic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
922345030 1:224689474-224689496 TTTGAGCAGCATCACACGGTGGG + Intronic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1064014227 10:11760370-11760392 GTTCTGCAGCTACACACTGCCGG + Intronic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1065823717 10:29550821-29550843 GTTCAGCAGCACCTCCGGGTCGG + Exonic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072675629 10:97463783-97463805 GTTGAACAGCACCACCCTCTGGG - Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1073401211 10:103259124-103259146 TTTCAGTAGCACCCCACTCTCGG - Intergenic
1075056397 10:119222058-119222080 GATCATCAGCACAACCCTGTGGG + Intronic
1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG + Intergenic
1076758274 10:132586515-132586537 GTTCCGCAGCACCAGACACTCGG - Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG + Intergenic
1078616596 11:12871674-12871696 GGGAAGCACCACCACACTGTGGG + Intronic
1078616705 11:12872557-12872579 TTTCTCCATCACCACACTGTTGG - Intronic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080341838 11:31273697-31273719 CTACAGCAGCACCCCACTCTTGG + Intronic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080923985 11:36737185-36737207 GTTAAGCAGCAGTACCCTGTAGG - Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1081742090 11:45448014-45448036 GTTCAGCAGAAAGACACTGGAGG + Intergenic
1082748562 11:56994708-56994730 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1083121979 11:60521785-60521807 TTTCAGCAGCACCCCACTCCTGG + Intronic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1087411278 11:97792851-97792873 GTCCAGCATCACTACACTGTAGG - Intergenic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1092662774 12:10756382-10756404 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1093763841 12:22939989-22940011 GTGCAGCAGCAGCACAATCTTGG + Intergenic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095206942 12:39449121-39449143 GTTCAGAAGGGCCACACTCTTGG - Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1096960360 12:55570863-55570885 TTTCAGCAGCACCCCACTTCTGG + Intergenic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1098238741 12:68443882-68443904 TTTCAGCAACACCCCACTCTCGG + Intergenic
1098650027 12:72953041-72953063 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1103695106 12:122808863-122808885 GAGCATCAGCACCACACTGATGG - Intronic
1103726703 12:123000787-123000809 GTTCAGCTGCTCCACACTGGAGG + Exonic
1104209577 12:126675632-126675654 GTTCAGCAGCAGCAACATGTAGG + Intergenic
1104607803 12:130202840-130202862 GATCAGCAGCAACACAAAGTGGG - Intergenic
1104608308 12:130205834-130205856 GATCAGCAGCAACACAAAGTGGG + Intergenic
1105968388 13:25405118-25405140 GTTCAGCAGCAAGAGGCTGTTGG + Intronic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1106192532 13:27466306-27466328 CTTCAGCAGGACCACAGTGGAGG + Intergenic
1106525804 13:30540342-30540364 TTTGAGCAGCACGACACTGGGGG + Intronic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1108165588 13:47689813-47689835 GTTCTGCAGCAGCACACTGGAGG + Intergenic
1108184433 13:47874186-47874208 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1108560959 13:51643536-51643558 GTTCATCAATACCACCCTGTAGG - Intronic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1109480517 13:62946037-62946059 TTTCTGCAGCACGACACTCTTGG + Intergenic
1112480037 13:99766869-99766891 GTTTAGCAGTACCACACTATAGG - Intronic
1113839824 13:113352871-113352893 ATCCAGCAGCCCCACACTCTAGG + Intronic
1114935886 14:27535677-27535699 GTGCAGCAGCACCCCATTTTTGG + Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116293409 14:43073180-43073202 TTTCAACAGCACCGCACTCTTGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1117095355 14:52291682-52291704 CTTGAATAGCACCACACTGTTGG + Intergenic
1117618067 14:57554473-57554495 GTTCAGCAGCTCCAAGCTATAGG - Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1118717280 14:68569358-68569380 GGTCAGCAGCAGCAAACTGAGGG + Intronic
1119966350 14:78920655-78920677 GGTCAGCTGCACAAAACTGTGGG - Intronic
1120381100 14:83780811-83780833 AATCAGCAGCACCAGACTGGAGG - Intergenic
1121063549 14:90939420-90939442 TTTCAGCAGCACCCCACTCGTGG + Intronic
1122356390 14:101125541-101125563 GTCCAGCGTCTCCACACTGTAGG - Intergenic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1130302749 15:82692420-82692442 GCTCAGCCGCACTGCACTGTGGG + Intronic
1130484544 15:84391402-84391424 GTTCAGCAGCCCCTCTCTGCAGG + Intergenic
1132172840 15:99680090-99680112 CTTCAGCAGCTCAACACTGAGGG - Intronic
1133550872 16:6853477-6853499 GTCCTCGAGCACCACACTGTAGG - Intronic
1137237377 16:46626656-46626678 GATCAGCAGCTGCACAATGTTGG + Intergenic
1137755985 16:50902641-50902663 GGTCAGCAACACCACCCAGTGGG - Intergenic
1138300291 16:55920416-55920438 CTACAGCAGCATCACACTGCAGG + Intronic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1139551538 16:67675752-67675774 GGTCAGCAGGTCCACAATGTAGG + Exonic
1143732879 17:8890894-8890916 GTTCAGCAGCAGCACGGTGCTGG + Exonic
1144233343 17:13231272-13231294 GTTCAGCACCAGCTCTCTGTGGG + Intergenic
1144762758 17:17716766-17716788 GTCCAGCAGCACCACACAGGAGG - Intronic
1145228073 17:21147856-21147878 GCTCAGCAACACAACACTGTAGG + Intronic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149131412 17:53306090-53306112 TTACAGCAGCACCCCACTGCTGG + Intergenic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1153929465 18:9865974-9865996 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156509942 18:37627893-37627915 GGTGAGCAGCACCACAGAGTGGG + Intergenic
1156858966 18:41814572-41814594 TTTCAGCAGCACCGCACTCCTGG + Intergenic
1157904331 18:51554865-51554887 TTTCAGCAGCATCACACCATAGG - Intergenic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1157988861 18:52471561-52471583 TTTCAGCAGCACCTAACTCTGGG + Intronic
1158482550 18:57834896-57834918 GATCACCAGGACCACACAGTAGG - Intergenic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1159906354 18:74096293-74096315 GTTCAGTAGCACCACACTACAGG + Intronic
1160429094 18:78799245-78799267 TTTCACCAGCACCACACTGCTGG + Intergenic
1160494755 18:79366336-79366358 GAACCGCAGAACCACACTGTGGG + Intronic
1161586333 19:5107783-5107805 GCTCAGCAGGGCCACAGTGTGGG - Intronic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1164708426 19:30337252-30337274 GCTCAGCAACCCCACTCTGTGGG - Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
925022352 2:581630-581652 TTTCATCAGCACCACACTCCCGG - Intergenic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
925628674 2:5867104-5867126 GGTCAGCAGCCCCACCCTGCTGG - Intergenic
925724350 2:6858813-6858835 TTTCAGCAGCACCCCACTTCTGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
926938829 2:18114340-18114362 TTACAGCAGCACCCCACTGCTGG - Intronic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
927888812 2:26735539-26735561 GATCATCAGAACAACACTGTGGG + Intergenic
927921830 2:26978398-26978420 TTTCCGCAGCACCAGACTCTTGG + Intronic
929523208 2:42674302-42674324 GTTAAGCAGAACCACACTATGGG - Intronic
930310464 2:49733097-49733119 ATTCAGCAGCACCCCACTCCTGG + Intergenic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
931331720 2:61293535-61293557 CTCCAGCAGCAACAAACTGTAGG + Exonic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
932799774 2:74730796-74730818 TTAGAGCAGCACCACACTGTAGG - Intergenic
933553339 2:83802799-83802821 CTCCACCAGCACCACAGTGTGGG + Intergenic
936087289 2:109477900-109477922 GTGCAGCAGCCCCACACCCTTGG + Intronic
936851567 2:116905229-116905251 ATTAAGCAGCACCATCCTGTAGG - Intergenic
938768185 2:134477820-134477842 GTACAGCTTCACCACTCTGTGGG - Intronic
939023335 2:136984192-136984214 GTACAGCTTCACCACTCTGTGGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941805753 2:169710822-169710844 GTTCAGAAGGACCCCACTCTTGG - Intronic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
946263562 2:218518837-218518859 ATGCAGCATCATCACACTGTGGG - Intronic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
947345709 2:229187273-229187295 TTTCAGCAGCACCCCACTCCTGG + Intronic
947387879 2:229610259-229610281 TTTCTGCAGCACGACACAGTGGG - Intronic
947712884 2:232325968-232325990 GTTGAGCCGCTCCACACTCTGGG - Intronic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1169676517 20:8160355-8160377 TTTCAGCAACACCACACTACTGG + Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171117483 20:22537568-22537590 GTTCTTCACCACCACACTCTAGG + Intergenic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1171789722 20:29511635-29511657 GTTTATGGGCACCACACTGTGGG - Intergenic
1172380257 20:34483767-34483789 CTTCAGCAGCACCCCACTCCTGG + Intronic
1172720065 20:36993142-36993164 TTTCAGCAGCACCCCACTTCTGG - Intergenic
1173482030 20:43409324-43409346 GTTCATCATCACCACACGGGAGG + Intergenic
1174391536 20:50221007-50221029 ATTAAGCAGCACCACCCTGGTGG - Intergenic
1177104841 21:16943030-16943052 GTTCAGCGGCACTATACTATAGG - Intergenic
1177684634 21:24419818-24419840 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1179451075 21:41468835-41468857 GTTCAGCAGAACCAAGCCGTTGG - Intronic
1179483749 21:41695414-41695436 GTGCTCCAGCACCACAGTGTAGG + Intergenic
1180670548 22:17549300-17549322 CGTCTGCAGCATCACACTGTGGG - Exonic
1182815063 22:33155166-33155188 TTTCAGCAGCACCCCACTCTTGG - Intergenic
949665161 3:6330836-6330858 TTTCAGCAGTACCCCACTGCTGG - Intergenic
949673419 3:6425447-6425469 TTTCAGCAGCACCTCACTCCTGG + Intergenic
950796455 3:15514310-15514332 GACCAGCAGCATCACACTCTTGG + Intronic
951318881 3:21220993-21221015 TTAAAGCAGCACAACACTGTAGG - Intergenic
951923306 3:27879284-27879306 GTTCTGAAGCACTACACTGGTGG + Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954711587 3:52507659-52507681 GCTCACCAGCTTCACACTGTTGG - Exonic
955122220 3:56072001-56072023 GTGCAGCAGCCATACACTGTTGG + Intronic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957655641 3:83070537-83070559 GTTTACCAGTACCACACTGTAGG + Intergenic
957777482 3:84772546-84772568 GTTTAGTAGAACCATACTGTTGG + Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
960297961 3:115967534-115967556 TTTCAGCAGCACCCCACTCCTGG + Intronic
961751023 3:129094987-129095009 GATCAGCAGCTGCACAATGTTGG + Exonic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963404116 3:144840659-144840681 CTTCAGCAGCATCACACTATAGG - Intergenic
963421158 3:145062257-145062279 TTTCAGCAGCACCCCACTCGTGG + Intergenic
963819267 3:149869996-149870018 ATTCAGTAGCACCATACAGTAGG - Intronic
964480641 3:157135059-157135081 ATTCAGCAACTCCACTCTGTGGG - Intergenic
964537124 3:157735175-157735197 GTTCAGCAGCTTCACACAGTAGG + Intergenic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965279758 3:166734776-166734798 GTTAAGCAGCATCACAAGGTAGG + Intergenic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
966684398 3:182678327-182678349 GTTCAGCTGCAGCTGACTGTAGG - Intergenic
967178937 3:186886320-186886342 GTTCTGCATCCCCACACTGAGGG - Intergenic
967462395 3:189761682-189761704 TTTCAGCAACACCACACTTCTGG + Intronic
968134474 3:196211199-196211221 GACCAGCAGCACCACATTGAAGG + Exonic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
968265471 3:197359659-197359681 TTTCAGCAGCACCCCACTCTTGG - Intergenic
969248831 4:5954121-5954143 GGACAGCAGCAGCACACAGTAGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970624518 4:17862101-17862123 TTTCAGCAGCACCCCACTCTTGG + Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
972227686 4:37032745-37032767 GTTCTGCATCATGACACTGTGGG - Intergenic
972242186 4:37204930-37204952 TTTCAGCAGCACCCCACTCCTGG + Intergenic
975216397 4:71760990-71761012 TTTCAGCAGCACCGCACTCCTGG - Intronic
975942035 4:79659677-79659699 TTTCAGTAGCACCCCACTCTTGG - Intergenic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
978969068 4:114780532-114780554 GTTCAATAGCACCACACTATAGG - Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980650676 4:135711259-135711281 TTACAGCAGCACCCCACTCTTGG - Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
982729337 4:158939005-158939027 TTTCAGAAGCCCCAAACTGTTGG - Intronic
983129931 4:164005775-164005797 GTTTGGCAGCACCACATTGTAGG + Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
983698635 4:170564315-170564337 GTTCAGCAGCACAGCTCTCTTGG + Intergenic
984379620 4:178974852-178974874 ATTCAGCAGAAGCACCCTGTTGG + Intergenic
984865434 4:184276570-184276592 GTATAGCAGCACCCCACTCTTGG - Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
986081211 5:4395932-4395954 TTTCAGCAACACCCCACTCTTGG + Intergenic
986412754 5:7497845-7497867 TTTCAGTAGCACCAGACTGAAGG + Intronic
986656852 5:10021301-10021323 GTTGAGCAGCACCACAACGTAGG + Intergenic
987260176 5:16195270-16195292 GATCAGCAGCATCAGTCTGTGGG + Intergenic
987379522 5:17272013-17272035 GTGCAGCAGCAGCACAATCTCGG - Intronic
987799404 5:22674521-22674543 TTTCAGCAGCACCCCACTCCTGG - Intronic
989390339 5:40894066-40894088 ATTCAGCAGCAGCACACTATAGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993414202 5:87605843-87605865 ATTCAGCAGTACCAACCTGTAGG - Intergenic
993936795 5:94014183-94014205 GTTCATCAGTATCACACTGTAGG + Intronic
994184164 5:96799950-96799972 GTTGAGAAGCACCACACTAGAGG + Intronic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995220265 5:109640528-109640550 TTTCAGCAGCACCTCACTCTTGG - Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
996600278 5:125254452-125254474 TTTCAGCAACACCCCACTCTTGG + Intergenic
997164583 5:131646191-131646213 ATTCTGTAGTACCACACTGTTGG - Intronic
997821478 5:137070003-137070025 TTGCAGCAGCACCTCCCTGTAGG + Intronic
997881626 5:137597153-137597175 GTTCAGCAGCTGCTCACTCTTGG + Intronic
998144422 5:139718589-139718611 TTTCAGCAGCACCCCACTCCTGG - Intergenic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999969765 5:156847612-156847634 ATTCAGCAGCAGTACATTGTAGG + Intergenic
1000741364 5:164973985-164974007 TTTCAGCAGCACCCCACTTGTGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1001426485 5:171625919-171625941 GGTCCTCAGGACCACACTGTTGG - Intergenic
1001734046 5:173984263-173984285 CTCCAGCAGCACCACGCTATGGG + Intronic
1001795394 5:174498153-174498175 TTTCAGCAGCACCCCACTCCTGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003590867 6:7435581-7435603 ATTTAGCAGTACGACACTGTAGG + Intergenic
1004876991 6:19966131-19966153 CGTGAGCTGCACCACACTGTGGG + Intergenic
1007182761 6:39942333-39942355 GTTAAACAGCAACTCACTGTAGG - Intergenic
1007367012 6:41401609-41401631 GTTTACCAGCACACCACTGTTGG + Intergenic
1007856729 6:44865372-44865394 TTTCAGCAGCACCCCACTCCTGG + Intronic
1010295865 6:74194937-74194959 GCTGAGCAGCAACACTCTGTAGG - Intergenic
1013184005 6:107741586-107741608 GTTACGCAGTACCACACTGTAGG + Intronic
1013799902 6:113930990-113931012 GTGTCTCAGCACCACACTGTAGG - Intergenic
1013918045 6:115365964-115365986 TTTCAGCAGCACCTCACTCCTGG - Intergenic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1014327703 6:120019211-120019233 TTTCAGCAGCACCACATTTCTGG + Intergenic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016281874 6:142427599-142427621 TTTCAGCAGCACCATACTTCTGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1016651129 6:146462228-146462250 ATTCAGTAGCACTGCACTGTTGG - Intergenic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1018503835 6:164442750-164442772 TTACAGCAGCACCCCACTCTTGG - Intergenic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1019131338 6:169879117-169879139 GTTCAGCAGCACGAGGCTATAGG - Intergenic
1020016406 7:4834482-4834504 GCTCAGCAGCACAGCACCGTGGG + Intronic
1020466161 7:8482101-8482123 GTTCAGCAGTTTCACTCTGTTGG - Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023060327 7:36320543-36320565 TTTCAGCAGCACCCCACTGCTGG - Intergenic
1023713964 7:43023771-43023793 CTTCAGGAACACCACACTCTTGG - Intergenic
1023734130 7:43219942-43219964 CCCCAGCAGCACCACACTGGAGG - Intronic
1024601174 7:50982863-50982885 ATTCAGCATCTCCACACTGAGGG - Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1027393475 7:77728534-77728556 GTTGAGCAGCGCCACACCATAGG - Intronic
1027603046 7:80263343-80263365 GTTCAACAAGACGACACTGTGGG + Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1028754561 7:94420534-94420556 GTTGACCAGCAGCACCCTGTTGG - Exonic
1029025474 7:97412838-97412860 TAACAGCATCACCACACTGTAGG + Intergenic
1031365365 7:120894799-120894821 TTTCAGCAGCACCCCATTCTCGG - Intergenic
1032179328 7:129661821-129661843 TTTCAGCAGCACCCCACTCCTGG + Intronic
1033134518 7:138773576-138773598 GGTCAACAGCACCACAAAGTGGG + Intronic
1034594605 7:152177789-152177811 GTTCAGCAGCACAACATACTGGG - Exonic
1034681757 7:152934168-152934190 TTTCGGCAGCACCACAATGTCGG - Intergenic
1035319087 7:158016916-158016938 GTGCAGCAGCAGGGCACTGTAGG - Intronic
1038024503 8:23576674-23576696 GTTCATCAGCACACCACTGCTGG + Intergenic
1040616881 8:49046292-49046314 GGTCACCAGAACCACACTGGAGG + Intergenic
1040768620 8:50946035-50946057 GTTCCTCAGCACCTCACCGTCGG + Intergenic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1041965029 8:63666647-63666669 GTTCAGCAGTACCCCACTTCTGG - Intergenic
1041996126 8:64060515-64060537 GTTCAGGAGCACCGTTCTGTAGG + Intergenic
1042002341 8:64138699-64138721 ATTCAGCAGCACTGTACTGTAGG + Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1043932672 8:86108537-86108559 GTTCAGCAGCAGCAGAGTGTGGG + Intronic
1044144609 8:88696299-88696321 GTTCGGCAACACTACACTGCAGG - Intergenic
1044877107 8:96680643-96680665 TTTCAGCAGCACCCCACTCCTGG - Intronic
1046506858 8:115147545-115147567 TTTCAGCAGCACCTCACTTCTGG + Intergenic
1046941092 8:119932316-119932338 GATCTGCATAACCACACTGTGGG + Intronic
1047064526 8:121265637-121265659 CAGCAGCAACACCACACTGTGGG + Intergenic
1047476657 8:125238851-125238873 GTTCTGCAGTAAGACACTGTGGG + Intronic
1048133538 8:131723295-131723317 GTTCAGCTAAACTACACTGTTGG + Intergenic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050079690 9:1903507-1903529 TTTCAGCAGCACCCCACTCCTGG - Intergenic
1050564335 9:6866466-6866488 GCTCAGCAGTGCTACACTGTAGG - Intronic
1050580705 9:7052769-7052791 GTGCAGCAGCACCACCTCGTGGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1056034029 9:82584904-82584926 GTGCAGCAACCCCACAATGTAGG + Intergenic
1056568999 9:87799511-87799533 GCTCAGCAGCTCCACAGTGCAGG - Intergenic
1056733605 9:89185810-89185832 GATCAGCCTCACCACAGTGTTGG + Intergenic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1057335105 9:94149224-94149246 GCTCAGAAGCACCACACATTTGG + Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060806540 9:126581173-126581195 ATTCACCAACTCCACACTGTGGG + Intergenic
1062226396 9:135454778-135454800 GTACAGCAGCACCCCACTTCTGG + Intergenic
1185724922 X:2411942-2411964 GGACAGAAGCACCACACTGGAGG + Intronic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187691967 X:21877647-21877669 GTTTACCAGCACCACAGTGCAGG + Intronic
1187819837 X:23275648-23275670 GTTCAGCAGCATCAGCATGTTGG - Intergenic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188382018 X:29506675-29506697 ATTCAGCAGTACTATACTGTAGG - Intronic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1188553361 X:31384596-31384618 CTTCAACAGCAGCATACTGTTGG - Intronic
1188748323 X:33874163-33874185 TTTCAACAGCACCCCACTGCTGG + Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1190498193 X:51047997-51048019 GTTTAACAGCACCACACAGTGGG + Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1192073082 X:67961803-67961825 TTTCACAAGCATCACACTGTGGG + Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193153324 X:78147345-78147367 TTTCAGCAGCACCCCACTTCTGG - Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194666623 X:96683968-96683990 GTGCAGCAGCAGGGCACTGTTGG - Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196548834 X:116997229-116997251 TTACAGCAGCACCCCACTCTTGG + Intergenic
1196664954 X:118305998-118306020 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1197551103 X:127893815-127893837 ATTTAGCAACACCACACAGTAGG - Intergenic
1197722726 X:129755985-129756007 GCTCAGCAGCCCCACCCTGGAGG + Intronic
1198303861 X:135360384-135360406 GATCAGCAGAACCCCACTCTGGG + Exonic
1198568898 X:137934425-137934447 TTTCAGCAGCACCCCACTCCTGG - Intergenic
1198636685 X:138710121-138710143 GTTCAAAAGCACCACAGTCTGGG + Intronic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic
1199515371 X:148669364-148669386 TTTCAGCAGCACCCCACTCCTGG + Intronic
1200075580 X:153549078-153549100 GTTCAGCATCTGCACAATGTGGG + Intronic