ID: 999413527

View in Genome Browser
Species Human (GRCh38)
Location 5:151374180-151374202
Sequence CGGACTCTTTCTCGATCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999413527_999413532 10 Left 999413527 5:151374180-151374202 CCTGAAGATCGAGAAAGAGTCCG No data
Right 999413532 5:151374213-151374235 AGGTACCAGTCATGTCAGACTGG No data
999413527_999413530 -10 Left 999413527 5:151374180-151374202 CCTGAAGATCGAGAAAGAGTCCG No data
Right 999413530 5:151374193-151374215 AAAGAGTCCGTCTGGGTACTAGG No data
999413527_999413533 11 Left 999413527 5:151374180-151374202 CCTGAAGATCGAGAAAGAGTCCG No data
Right 999413533 5:151374214-151374236 GGTACCAGTCATGTCAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999413527 Original CRISPR CGGACTCTTTCTCGATCTTC AGG (reversed) Intergenic
No off target data available for this crispr