ID: 999418414

View in Genome Browser
Species Human (GRCh38)
Location 5:151419839-151419861
Sequence AAGGATGGCAGATCCCGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418414_999418425 20 Left 999418414 5:151419839-151419861 CCTCAACGGGATCTGCCATCCTT No data
Right 999418425 5:151419882-151419904 GGACAAGATACCTCCCCCAGTGG No data
999418414_999418427 26 Left 999418414 5:151419839-151419861 CCTCAACGGGATCTGCCATCCTT No data
Right 999418427 5:151419888-151419910 GATACCTCCCCCAGTGGGCGTGG No data
999418414_999418417 -6 Left 999418414 5:151419839-151419861 CCTCAACGGGATCTGCCATCCTT No data
Right 999418417 5:151419856-151419878 ATCCTTCCCCATCCCAGGCAAGG No data
999418414_999418419 -1 Left 999418414 5:151419839-151419861 CCTCAACGGGATCTGCCATCCTT No data
Right 999418419 5:151419861-151419883 TCCCCATCCCAGGCAAGGAGAGG No data
999418414_999418426 21 Left 999418414 5:151419839-151419861 CCTCAACGGGATCTGCCATCCTT No data
Right 999418426 5:151419883-151419905 GACAAGATACCTCCCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418414 Original CRISPR AAGGATGGCAGATCCCGTTG AGG (reversed) Intergenic
No off target data available for this crispr