ID: 999418416

View in Genome Browser
Species Human (GRCh38)
Location 5:151419854-151419876
Sequence TTGCCTGGGATGGGGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418416_999418427 11 Left 999418416 5:151419854-151419876 CCATCCTTCCCCATCCCAGGCAA No data
Right 999418427 5:151419888-151419910 GATACCTCCCCCAGTGGGCGTGG No data
999418416_999418435 24 Left 999418416 5:151419854-151419876 CCATCCTTCCCCATCCCAGGCAA No data
Right 999418435 5:151419901-151419923 GTGGGCGTGGTCAGGGAGCCAGG No data
999418416_999418425 5 Left 999418416 5:151419854-151419876 CCATCCTTCCCCATCCCAGGCAA No data
Right 999418425 5:151419882-151419904 GGACAAGATACCTCCCCCAGTGG No data
999418416_999418430 17 Left 999418416 5:151419854-151419876 CCATCCTTCCCCATCCCAGGCAA No data
Right 999418430 5:151419894-151419916 TCCCCCAGTGGGCGTGGTCAGGG No data
999418416_999418436 29 Left 999418416 5:151419854-151419876 CCATCCTTCCCCATCCCAGGCAA No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418416_999418429 16 Left 999418416 5:151419854-151419876 CCATCCTTCCCCATCCCAGGCAA No data
Right 999418429 5:151419893-151419915 CTCCCCCAGTGGGCGTGGTCAGG No data
999418416_999418437 30 Left 999418416 5:151419854-151419876 CCATCCTTCCCCATCCCAGGCAA No data
Right 999418437 5:151419907-151419929 GTGGTCAGGGAGCCAGGCATGGG No data
999418416_999418426 6 Left 999418416 5:151419854-151419876 CCATCCTTCCCCATCCCAGGCAA No data
Right 999418426 5:151419883-151419905 GACAAGATACCTCCCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418416 Original CRISPR TTGCCTGGGATGGGGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr