ID: 999418418

View in Genome Browser
Species Human (GRCh38)
Location 5:151419858-151419880
Sequence CTCCTTGCCTGGGATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418418_999418438 27 Left 999418418 5:151419858-151419880 CCTTCCCCATCCCAGGCAAGGAG No data
Right 999418438 5:151419908-151419930 TGGTCAGGGAGCCAGGCATGGGG No data
999418418_999418427 7 Left 999418418 5:151419858-151419880 CCTTCCCCATCCCAGGCAAGGAG No data
Right 999418427 5:151419888-151419910 GATACCTCCCCCAGTGGGCGTGG No data
999418418_999418439 28 Left 999418418 5:151419858-151419880 CCTTCCCCATCCCAGGCAAGGAG No data
Right 999418439 5:151419909-151419931 GGTCAGGGAGCCAGGCATGGGGG No data
999418418_999418426 2 Left 999418418 5:151419858-151419880 CCTTCCCCATCCCAGGCAAGGAG No data
Right 999418426 5:151419883-151419905 GACAAGATACCTCCCCCAGTGGG No data
999418418_999418429 12 Left 999418418 5:151419858-151419880 CCTTCCCCATCCCAGGCAAGGAG No data
Right 999418429 5:151419893-151419915 CTCCCCCAGTGGGCGTGGTCAGG No data
999418418_999418437 26 Left 999418418 5:151419858-151419880 CCTTCCCCATCCCAGGCAAGGAG No data
Right 999418437 5:151419907-151419929 GTGGTCAGGGAGCCAGGCATGGG No data
999418418_999418436 25 Left 999418418 5:151419858-151419880 CCTTCCCCATCCCAGGCAAGGAG No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418418_999418425 1 Left 999418418 5:151419858-151419880 CCTTCCCCATCCCAGGCAAGGAG No data
Right 999418425 5:151419882-151419904 GGACAAGATACCTCCCCCAGTGG No data
999418418_999418430 13 Left 999418418 5:151419858-151419880 CCTTCCCCATCCCAGGCAAGGAG No data
Right 999418430 5:151419894-151419916 TCCCCCAGTGGGCGTGGTCAGGG No data
999418418_999418435 20 Left 999418418 5:151419858-151419880 CCTTCCCCATCCCAGGCAAGGAG No data
Right 999418435 5:151419901-151419923 GTGGGCGTGGTCAGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418418 Original CRISPR CTCCTTGCCTGGGATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr