ID: 999418419

View in Genome Browser
Species Human (GRCh38)
Location 5:151419861-151419883
Sequence TCCCCATCCCAGGCAAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418414_999418419 -1 Left 999418414 5:151419839-151419861 CCTCAACGGGATCTGCCATCCTT No data
Right 999418419 5:151419861-151419883 TCCCCATCCCAGGCAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418419 Original CRISPR TCCCCATCCCAGGCAAGGAG AGG Intergenic
No off target data available for this crispr