ID: 999418420

View in Genome Browser
Species Human (GRCh38)
Location 5:151419862-151419884
Sequence TCCTCTCCTTGCCTGGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418420_999418440 28 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418420_999418430 9 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418430 5:151419894-151419916 TCCCCCAGTGGGCGTGGTCAGGG No data
999418420_999418436 21 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418420_999418426 -2 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418426 5:151419883-151419905 GACAAGATACCTCCCCCAGTGGG No data
999418420_999418427 3 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418427 5:151419888-151419910 GATACCTCCCCCAGTGGGCGTGG No data
999418420_999418438 23 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418438 5:151419908-151419930 TGGTCAGGGAGCCAGGCATGGGG No data
999418420_999418437 22 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418437 5:151419907-151419929 GTGGTCAGGGAGCCAGGCATGGG No data
999418420_999418435 16 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418435 5:151419901-151419923 GTGGGCGTGGTCAGGGAGCCAGG No data
999418420_999418429 8 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418429 5:151419893-151419915 CTCCCCCAGTGGGCGTGGTCAGG No data
999418420_999418439 24 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418439 5:151419909-151419931 GGTCAGGGAGCCAGGCATGGGGG No data
999418420_999418425 -3 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418425 5:151419882-151419904 GGACAAGATACCTCCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418420 Original CRISPR TCCTCTCCTTGCCTGGGATG GGG (reversed) Intergenic
No off target data available for this crispr