ID: 999418422

View in Genome Browser
Species Human (GRCh38)
Location 5:151419864-151419886
Sequence TGTCCTCTCCTTGCCTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418422_999418425 -5 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418425 5:151419882-151419904 GGACAAGATACCTCCCCCAGTGG No data
999418422_999418426 -4 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418426 5:151419883-151419905 GACAAGATACCTCCCCCAGTGGG No data
999418422_999418440 26 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418422_999418429 6 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418429 5:151419893-151419915 CTCCCCCAGTGGGCGTGGTCAGG No data
999418422_999418437 20 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418437 5:151419907-151419929 GTGGTCAGGGAGCCAGGCATGGG No data
999418422_999418438 21 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418438 5:151419908-151419930 TGGTCAGGGAGCCAGGCATGGGG No data
999418422_999418436 19 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418422_999418439 22 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418439 5:151419909-151419931 GGTCAGGGAGCCAGGCATGGGGG No data
999418422_999418435 14 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418435 5:151419901-151419923 GTGGGCGTGGTCAGGGAGCCAGG No data
999418422_999418430 7 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418430 5:151419894-151419916 TCCCCCAGTGGGCGTGGTCAGGG No data
999418422_999418427 1 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418427 5:151419888-151419910 GATACCTCCCCCAGTGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418422 Original CRISPR TGTCCTCTCCTTGCCTGGGA TGG (reversed) Intergenic
No off target data available for this crispr