ID: 999418428

View in Genome Browser
Species Human (GRCh38)
Location 5:151419892-151419914
Sequence CTGACCACGCCCACTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418428_999418436 -9 Left 999418428 5:151419892-151419914 CCTCCCCCAGTGGGCGTGGTCAG No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418428_999418438 -7 Left 999418428 5:151419892-151419914 CCTCCCCCAGTGGGCGTGGTCAG No data
Right 999418438 5:151419908-151419930 TGGTCAGGGAGCCAGGCATGGGG No data
999418428_999418440 -2 Left 999418428 5:151419892-151419914 CCTCCCCCAGTGGGCGTGGTCAG No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418428_999418437 -8 Left 999418428 5:151419892-151419914 CCTCCCCCAGTGGGCGTGGTCAG No data
Right 999418437 5:151419907-151419929 GTGGTCAGGGAGCCAGGCATGGG No data
999418428_999418439 -6 Left 999418428 5:151419892-151419914 CCTCCCCCAGTGGGCGTGGTCAG No data
Right 999418439 5:151419909-151419931 GGTCAGGGAGCCAGGCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418428 Original CRISPR CTGACCACGCCCACTGGGGG AGG (reversed) Intergenic
No off target data available for this crispr