ID: 999418431

View in Genome Browser
Species Human (GRCh38)
Location 5:151419895-151419917
Sequence TCCCTGACCACGCCCACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418431_999418439 -9 Left 999418431 5:151419895-151419917 CCCCCAGTGGGCGTGGTCAGGGA No data
Right 999418439 5:151419909-151419931 GGTCAGGGAGCCAGGCATGGGGG No data
999418431_999418438 -10 Left 999418431 5:151419895-151419917 CCCCCAGTGGGCGTGGTCAGGGA No data
Right 999418438 5:151419908-151419930 TGGTCAGGGAGCCAGGCATGGGG No data
999418431_999418440 -5 Left 999418431 5:151419895-151419917 CCCCCAGTGGGCGTGGTCAGGGA No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418431 Original CRISPR TCCCTGACCACGCCCACTGG GGG (reversed) Intergenic
No off target data available for this crispr