ID: 999418433

View in Genome Browser
Species Human (GRCh38)
Location 5:151419897-151419919
Sequence GCTCCCTGACCACGCCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418433_999418440 -7 Left 999418433 5:151419897-151419919 CCCAGTGGGCGTGGTCAGGGAGC No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418433 Original CRISPR GCTCCCTGACCACGCCCACT GGG (reversed) Intergenic
No off target data available for this crispr