ID: 999418434

View in Genome Browser
Species Human (GRCh38)
Location 5:151419898-151419920
Sequence GGCTCCCTGACCACGCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418434_999418440 -8 Left 999418434 5:151419898-151419920 CCAGTGGGCGTGGTCAGGGAGCC No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418434 Original CRISPR GGCTCCCTGACCACGCCCAC TGG (reversed) Intergenic
No off target data available for this crispr