ID: 999418436

View in Genome Browser
Species Human (GRCh38)
Location 5:151419906-151419928
Sequence CGTGGTCAGGGAGCCAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418428_999418436 -9 Left 999418428 5:151419892-151419914 CCTCCCCCAGTGGGCGTGGTCAG No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418424_999418436 14 Left 999418424 5:151419869-151419891 CCAGGCAAGGAGAGGACAAGATA No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418422_999418436 19 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418421_999418436 20 Left 999418421 5:151419863-151419885 CCCATCCCAGGCAAGGAGAGGAC No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418420_999418436 21 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418416_999418436 29 Left 999418416 5:151419854-151419876 CCATCCTTCCCCATCCCAGGCAA No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418423_999418436 15 Left 999418423 5:151419868-151419890 CCCAGGCAAGGAGAGGACAAGAT No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data
999418418_999418436 25 Left 999418418 5:151419858-151419880 CCTTCCCCATCCCAGGCAAGGAG No data
Right 999418436 5:151419906-151419928 CGTGGTCAGGGAGCCAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418436 Original CRISPR CGTGGTCAGGGAGCCAGGCA TGG Intergenic
No off target data available for this crispr