ID: 999418440

View in Genome Browser
Species Human (GRCh38)
Location 5:151419913-151419935
Sequence AGGGAGCCAGGCATGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999418423_999418440 22 Left 999418423 5:151419868-151419890 CCCAGGCAAGGAGAGGACAAGAT No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418434_999418440 -8 Left 999418434 5:151419898-151419920 CCAGTGGGCGTGGTCAGGGAGCC No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418431_999418440 -5 Left 999418431 5:151419895-151419917 CCCCCAGTGGGCGTGGTCAGGGA No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418422_999418440 26 Left 999418422 5:151419864-151419886 CCATCCCAGGCAAGGAGAGGACA No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418432_999418440 -6 Left 999418432 5:151419896-151419918 CCCCAGTGGGCGTGGTCAGGGAG No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418433_999418440 -7 Left 999418433 5:151419897-151419919 CCCAGTGGGCGTGGTCAGGGAGC No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418421_999418440 27 Left 999418421 5:151419863-151419885 CCCATCCCAGGCAAGGAGAGGAC No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418428_999418440 -2 Left 999418428 5:151419892-151419914 CCTCCCCCAGTGGGCGTGGTCAG No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418424_999418440 21 Left 999418424 5:151419869-151419891 CCAGGCAAGGAGAGGACAAGATA No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data
999418420_999418440 28 Left 999418420 5:151419862-151419884 CCCCATCCCAGGCAAGGAGAGGA No data
Right 999418440 5:151419913-151419935 AGGGAGCCAGGCATGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999418440 Original CRISPR AGGGAGCCAGGCATGGGGGC TGG Intergenic
No off target data available for this crispr