ID: 999424951

View in Genome Browser
Species Human (GRCh38)
Location 5:151479455-151479477
Sequence CCTGTTTGTGCGCACAGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999424945_999424951 10 Left 999424945 5:151479422-151479444 CCGAGCGCCCGAGCACTGTGAGT 0: 1
1: 0
2: 0
3: 7
4: 67
Right 999424951 5:151479455-151479477 CCTGTTTGTGCGCACAGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 102
999424941_999424951 25 Left 999424941 5:151479407-151479429 CCCCTTCTTTGTGTCCCGAGCGC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 999424951 5:151479455-151479477 CCTGTTTGTGCGCACAGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 102
999424943_999424951 23 Left 999424943 5:151479409-151479431 CCTTCTTTGTGTCCCGAGCGCCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 999424951 5:151479455-151479477 CCTGTTTGTGCGCACAGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 102
999424944_999424951 11 Left 999424944 5:151479421-151479443 CCCGAGCGCCCGAGCACTGTGAG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 999424951 5:151479455-151479477 CCTGTTTGTGCGCACAGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 102
999424947_999424951 3 Left 999424947 5:151479429-151479451 CCCGAGCACTGTGAGTTAGTGGT 0: 1
1: 0
2: 2
3: 8
4: 105
Right 999424951 5:151479455-151479477 CCTGTTTGTGCGCACAGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 102
999424942_999424951 24 Left 999424942 5:151479408-151479430 CCCTTCTTTGTGTCCCGAGCGCC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 999424951 5:151479455-151479477 CCTGTTTGTGCGCACAGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 102
999424948_999424951 2 Left 999424948 5:151479430-151479452 CCGAGCACTGTGAGTTAGTGGTG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 999424951 5:151479455-151479477 CCTGTTTGTGCGCACAGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999424951 Original CRISPR CCTGTTTGTGCGCACAGTGC TGG Exonic
900496824 1:2979483-2979505 AGCGTTTGTGCGCACAGGGCCGG - Intergenic
902652536 1:17845929-17845951 CGTGTGTGTGCACACACTGCAGG + Intergenic
903060145 1:20663653-20663675 CCTGTTTGTGCCCACATAGGGGG - Intergenic
903240843 1:21981528-21981550 CCTCCTTGTGCCCATAGTGCTGG - Intronic
906648210 1:47491423-47491445 CCTGTGAGAGCCCACAGTGCTGG + Intergenic
912510509 1:110186713-110186735 CCTGTTTGTATGAACAGTGCTGG - Intronic
916311828 1:163406690-163406712 CCTGTTTTTCTGCACAGTGGGGG + Intergenic
922571994 1:226639837-226639859 CCTGTGTCTGGGCACAGGGCAGG - Intronic
924466650 1:244304473-244304495 CCTGTCTGTTGGCACATTGCTGG + Intergenic
1063063834 10:2588638-2588660 ACTGTTTGTGTGAACAGTGTTGG + Intergenic
1063827977 10:9920327-9920349 CCTGTGTGTGGGCACTGTACTGG + Intergenic
1067070461 10:43127136-43127158 CCTGGCTGTGCTCCCAGTGCAGG - Intronic
1067665324 10:48273129-48273151 TTTGTTTTTGCTCACAGTGCTGG + Intronic
1071514096 10:86285555-86285577 CCAGGTGGTGGGCACAGTGCTGG - Intronic
1072387172 10:94942527-94942549 CATGATTGTGCGTACAGTGTGGG + Intronic
1073584075 10:104692008-104692030 CCTGTATGTGTCCACATTGCAGG - Intronic
1076740162 10:132478936-132478958 CGTGTTTGCTCCCACAGTGCTGG + Intergenic
1077373410 11:2194102-2194124 CATGTGTGTGCACACAGGGCCGG - Intergenic
1083923445 11:65792492-65792514 GCTGTCTGTGCCCACAGGGCTGG - Intronic
1092261373 12:6955034-6955056 CCTGTCTGTGACCACAGTGTGGG + Intronic
1092893238 12:12989124-12989146 ACTGCTTGTTCACACAGTGCAGG + Intronic
1093563503 12:20573324-20573346 CCTGTGTGTAGGCACAGTGCTGG + Intronic
1099797075 12:87412577-87412599 CCTGGTGGTGGGCACAGTGGCGG - Intergenic
1099886844 12:88541892-88541914 CAAGTGTGTGGGCACAGTGCAGG + Intronic
1101774683 12:107782876-107782898 CCAGTTTCTGCCCACAGAGCAGG + Intergenic
1102030727 12:109738723-109738745 CCTTTGTGTGCCCACAGTTCAGG + Intronic
1103869896 12:124083988-124084010 CCTGTTTTTGCTCAGAGTCCCGG + Intronic
1106299375 13:28450126-28450148 ACTGTCCGTGTGCACAGTGCTGG - Intronic
1106875947 13:34072942-34072964 TCTGTTTATGTGGACAGTGCTGG + Intergenic
1116560161 14:46368458-46368480 CCAGTTTGTGCCTGCAGTGCTGG - Intergenic
1121638935 14:95472545-95472567 CATGCTTGTATGCACAGTGCAGG - Intronic
1122551633 14:102553169-102553191 TGTGTTTGAGCGTACAGTGCTGG - Intergenic
1122786439 14:104166313-104166335 CCTGTATGTGGTCACTGTGCTGG + Intronic
1129262679 15:74377429-74377451 CCTGCTTCTGCCCCCAGTGCTGG - Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1132825034 16:1900410-1900432 CCTGTGTGTGCGTGCTGTGCAGG + Intergenic
1132925697 16:2428299-2428321 CCTGTCTGTGTGCCCAGGGCAGG + Intergenic
1137869661 16:51937837-51937859 CCTGTCTGTGCTCACAGCACGGG - Intergenic
1138167314 16:54815314-54815336 CTTGTTTGTCCTCACAGTGTTGG - Intergenic
1141096363 16:81165838-81165860 CCTGTTTGTGTACACAGAGATGG + Intergenic
1144704210 17:17356656-17356678 CGTGTGTGGGCGCTCAGTGCTGG - Intergenic
1147563311 17:41521964-41521986 CCTTTGTGTGTGCACAGTGCAGG - Exonic
1150832384 17:68535756-68535778 CCTGTTTAGGCCCAAAGTGCTGG + Intronic
1151654904 17:75491305-75491327 CCTGTTTGTCCACACAGCACAGG - Exonic
1152137131 17:78511091-78511113 CCTGTGTTTTCTCACAGTGCTGG - Intronic
1154126132 18:11694097-11694119 CCTGTCTTGGCCCACAGTGCTGG + Intronic
1160750642 19:732704-732726 CCTGGTTCTGGGCACAGTCCTGG + Intronic
928340025 2:30435056-30435078 CCTGTTTCTCAGCACAGTGCTGG - Intergenic
929996147 2:46827336-46827358 AGTGTATGTGTGCACAGTGCTGG + Intronic
933161017 2:79025527-79025549 ACTGTTTGTGGGGAAAGTGCCGG + Intergenic
933650500 2:84846526-84846548 CCTGCTGGTGAGCACAGTGGGGG - Intronic
933797215 2:85929227-85929249 CCCGTGTGTGCGCACAGCCCTGG + Intergenic
939948052 2:148434161-148434183 CCAGTTTGTGGTCACAGTGGTGG + Intronic
942566389 2:177268307-177268329 CCTGTTTGTGCTCCCAATGTTGG - Intronic
945013055 2:205485460-205485482 CTTGTGTGTGCATACAGTGCAGG - Intronic
946617449 2:221525212-221525234 CCTCTCTGTGCTCACATTGCCGG - Intronic
1173088437 20:39947374-39947396 CCTGTTTGAGTGCACAGTTTTGG + Intergenic
1173236342 20:41249523-41249545 CCTGGTTGGCCGCCCAGTGCAGG - Intronic
1174450883 20:50619566-50619588 CGTGTGTGGGCTCACAGTGCAGG + Intronic
1175838156 20:62009623-62009645 CCCGTTTGTACACACAGTGTCGG - Intronic
1178389942 21:32189901-32189923 CCTGTTTGTGCTCCCAGCGCAGG + Intergenic
1179912948 21:44459914-44459936 CCTGACTGAGCTCACAGTGCAGG - Exonic
1182567447 22:31210917-31210939 CCTGAGTGTGCACAAAGTGCTGG - Intergenic
1184897263 22:47417762-47417784 GCTGTATGTGTGCAGAGTGCAGG + Intergenic
950454799 3:13086284-13086306 CCGGTTTGTGCCCACCGTGGCGG + Intergenic
953651473 3:44809109-44809131 CCAGTTCCTGCGGACAGTGCTGG - Intronic
954710797 3:52504253-52504275 CCTGTTTGTTCCCACAGCCCTGG - Intronic
954712672 3:52512813-52512835 CCTGTGTGCGTGCAGAGTGCCGG + Exonic
958524904 3:95243721-95243743 CATGTTTGTGAGCACACTTCTGG + Intergenic
962671125 3:137709824-137709846 CCTGTGAGTGAGCACAGAGCCGG - Intergenic
965538659 3:169850899-169850921 GTAGTTTGTGCACACAGTGCTGG + Intronic
968521418 4:1036275-1036297 GCGGCTTGTGCGCCCAGTGCTGG + Intergenic
968731998 4:2273625-2273647 CCTGGGGGTGGGCACAGTGCAGG - Intronic
968850066 4:3073173-3073195 GCTGTTTGTGGCCACAGAGCAGG + Intergenic
969364514 4:6686355-6686377 CCTGCCTGTGAGCACAGGGCTGG - Intergenic
969457390 4:7307982-7308004 CCTGTGTGTGTGCACAGAGTGGG + Intronic
969481954 4:7451453-7451475 CCTCTTTGTCAGCCCAGTGCTGG + Intronic
969511199 4:7618919-7618941 CATGCCTGTGTGCACAGTGCGGG + Intronic
969704978 4:8786708-8786730 CCTGTTTCAGAGCACAGAGCAGG + Intergenic
975319845 4:72997528-72997550 CCAGACTGTGGGCACAGTGCGGG - Intergenic
979885376 4:126021545-126021567 CCTGTTTGTTAGGACAGTCCTGG - Intergenic
982343771 4:154333354-154333376 CGTGGTTGTGCTCACGGTGCAGG - Exonic
989792338 5:45420839-45420861 CCTGGTTTTCAGCACAGTGCTGG - Intronic
995361420 5:111302377-111302399 AGTGTGTGTGCGCACCGTGCGGG + Intronic
998461809 5:142315121-142315143 CCTGTTTCTCCGTACAGTCCAGG - Exonic
999424951 5:151479455-151479477 CCTGTTTGTGCGCACAGTGCTGG + Exonic
999501092 5:152147482-152147504 CCTGTTTCTGTTCTCAGTGCTGG + Intergenic
1001667752 5:173447314-173447336 CCTCTTTATGCGCACAGAGATGG + Intergenic
1007480941 6:42149361-42149383 CCTGTTTGTTCGGGGAGTGCTGG + Intergenic
1017783087 6:157731891-157731913 CCTCATGGAGCGCACAGTGCTGG + Intronic
1018422303 6:163650089-163650111 CCTGTTTCTGAGCACACAGCCGG + Intergenic
1018698827 6:166411567-166411589 CCTGGGTGTGCACACAGGGCGGG - Exonic
1022256145 7:28660568-28660590 CATGTTTGTGTGGACAGTACTGG - Intronic
1024301677 7:47891767-47891789 CTTGTTTTTGGGCACTGTGCAGG + Intronic
1037827529 8:22168218-22168240 TCTGTTTGTGTGCTCAGAGCTGG + Intronic
1049206374 8:141365529-141365551 CCCATTTGTGCCCGCAGTGCTGG - Intronic
1056705420 9:88948610-88948632 TGTGTCTGTGCGCACAGTGTGGG + Intergenic
1060477574 9:123997862-123997884 CATCTTTGGGTGCACAGTGCTGG + Intergenic
1061587810 9:131579827-131579849 CCTGTTTGTGCTCCATGTGCTGG - Intronic
1062369921 9:136233096-136233118 GCTGTTTGTGCACACGCTGCCGG + Intronic
1192180379 X:68912327-68912349 CTTGTGTGTGCGCACGGAGCGGG + Intergenic
1193928666 X:87524047-87524069 CCTCTTTGAGGGCAGAGTGCTGG - Intronic
1193990378 X:88299715-88299737 CCTCTTTGTGAGCACATTCCTGG - Intergenic
1200066312 X:153505729-153505751 CATGCTTGTGAGCAGAGTGCAGG - Intronic
1202334477 Y:23792723-23792745 CCTTTTTTTGAGCACAGAGCTGG - Intergenic
1202350775 Y:23988424-23988446 CCTTTTTTTGAGCACAGAGCTGG - Intergenic
1202520004 Y:25681696-25681718 CCTTTTTTTGAGCACAGAGCTGG + Intergenic
1202536291 Y:25877336-25877358 CCTTTTTTTGAGCACAGAGCTGG + Intergenic