ID: 999428827

View in Genome Browser
Species Human (GRCh38)
Location 5:151508980-151509002
Sequence GTTTTAGGGCTCCCAAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999428827_999428832 9 Left 999428827 5:151508980-151509002 CCCAAGTTTGGGAGCCCTAAAAC 0: 1
1: 0
2: 1
3: 10
4: 106
Right 999428832 5:151509012-151509034 GTCAAAGTCTCTTTCTCTCTAGG 0: 1
1: 0
2: 1
3: 37
4: 312
999428827_999428833 17 Left 999428827 5:151508980-151509002 CCCAAGTTTGGGAGCCCTAAAAC 0: 1
1: 0
2: 1
3: 10
4: 106
Right 999428833 5:151509020-151509042 CTCTTTCTCTCTAGGATTCTAGG 0: 1
1: 0
2: 1
3: 42
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999428827 Original CRISPR GTTTTAGGGCTCCCAAACTT GGG (reversed) Intronic
903496206 1:23769248-23769270 GTTTTGGTGCACCCAACCTTTGG - Intergenic
907785763 1:57611171-57611193 GTTTCAGGCCTCCCAAACTCAGG + Intronic
907846899 1:58216993-58217015 CTTTCAGGGCTCCCAAAATTGGG + Intronic
909518206 1:76536224-76536246 GTTTTAGAGCTCACAAACACTGG + Intronic
911752240 1:101508684-101508706 GTTTTAGGGCTATGAAACTTGGG + Intergenic
913093314 1:115494512-115494534 CTTTTAGGGCTAACAAATTTAGG + Intergenic
913378835 1:118186087-118186109 GTTTTAGGCCTGCCAAAATGAGG + Intergenic
916669136 1:166996792-166996814 GTTTCAGGGTGCCCAATCTTTGG + Intronic
918387257 1:184022059-184022081 GTCTTAGGGCTCAAAAACTAAGG + Intronic
921154498 1:212428463-212428485 CTTTTAGGCAGCCCAAACTTAGG - Intergenic
1068260777 10:54578233-54578255 GTTTGAGGGCCCCTAATCTTGGG + Intronic
1068804783 10:61183278-61183300 TTTTGGGGACTCCCAAACTTTGG - Intergenic
1068954264 10:62807077-62807099 ATTTTAGGGCACCAAAACTTGGG + Exonic
1081421639 11:42878738-42878760 GTTTTTGTACTCCCAAAATTGGG - Intergenic
1085365792 11:75942869-75942891 GTTTTAAGGCTCATAAACTAAGG - Intronic
1087540668 11:99514103-99514125 ATTTTAGGGGTCCAAGACTTCGG + Intronic
1097068338 12:56337023-56337045 CTTTTAGGGCTCCCAGAATGGGG + Intronic
1097892360 12:64790832-64790854 GTTTTAGTGCCACCAAACTCAGG - Intronic
1098001076 12:65943961-65943983 GTTTTAGTGCTTCCTAAGTTGGG - Intronic
1098301932 12:69063283-69063305 GTTTTAGGTTGGCCAAACTTTGG - Intergenic
1100371560 12:93973442-93973464 GTTTAAGGGCCTCCAAAATTTGG + Intergenic
1103493175 12:121339422-121339444 GTTCTTGGGCTCCAATACTTTGG - Intronic
1105039098 12:132947860-132947882 GGTTAAGGGCTCCAAAAGTTTGG - Intronic
1112269843 13:97958599-97958621 GATTTAGGCCTCACAAACCTTGG + Intronic
1112476356 13:99734512-99734534 ATTTCAGGGCTCCCTAACTTGGG - Intronic
1114855321 14:26432315-26432337 TTTTTATCACTCCCAAACTTAGG - Intergenic
1115862141 14:37699474-37699496 GTTTCAAGGCTCCTAGACTTTGG - Intronic
1117985819 14:61385266-61385288 GTTTTATGGCTCCCCAAATCAGG - Intronic
1119434801 14:74591282-74591304 GGGTTAGGGCTGGCAAACTTTGG + Intronic
1122222256 14:100247207-100247229 GTTTTAAGGCTGGGAAACTTAGG + Intronic
1123837786 15:24213604-24213626 GTTTTGGGGTTTCTAAACTTAGG - Intergenic
1123846947 15:24312543-24312565 GTTTTAGGCAGCCCAAACCTAGG + Intergenic
1125532672 15:40423850-40423872 ATTTCAGGGCTCCCAAACACTGG - Intronic
1126758752 15:51949959-51949981 GTTTGAGGGCTTCCATACGTAGG - Exonic
1127215367 15:56818069-56818091 GTTTTAGGGATTCCAAAACTGGG + Intronic
1129119829 15:73389559-73389581 TTTTTTGGGCTCCCAAAGCTGGG - Intergenic
1129381621 15:75171331-75171353 TTTTTGGGGCTCCAAAATTTTGG + Intergenic
1130386543 15:83417007-83417029 GTTTTAGGCCACCCACACTGTGG - Intergenic
1130925086 15:88379533-88379555 AGTTAAGGGCTCTCAAACTTAGG - Intergenic
1136641792 16:31571336-31571358 GTTTTAGGTGTTCCAAAGTTGGG - Intergenic
1139171291 16:64632828-64632850 GTTCTAGGGCTCACAATCTGTGG + Intergenic
1139227472 16:65247052-65247074 GCTTTAGGGCTGCCAAAACTGGG + Intergenic
1142311533 16:89316994-89317016 GCTTTAGGGCACCCACCCTTGGG + Exonic
1142744369 17:1948347-1948369 GTTCTGGGGCCCCCAAACCTGGG - Intronic
1143609473 17:8009439-8009461 GTTCTAGGGCTCCCCATCGTGGG + Intronic
1144177049 17:12717587-12717609 ATTTTATGGCTTCCCAACTTGGG - Intronic
1148194681 17:45704819-45704841 GTCCTGGGACTCCCAAACTTGGG + Intergenic
1150705963 17:67487672-67487694 TTTTTCCGGCTGCCAAACTTTGG + Intronic
1153112217 18:1605105-1605127 GTTTTAAGGCTACTAAATTTGGG + Intergenic
1153693073 18:7613142-7613164 ATTGGAGGGCTCTCAAACTTGGG + Intronic
1157210390 18:45737108-45737130 AATTTAGGGTTCCCAAGCTTTGG + Intronic
1160328036 18:77968442-77968464 GTTTTACGGCTCCCAGATTGTGG + Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
929935687 2:46293026-46293048 GTTTTAAGGCTTCCAAAATCAGG - Intergenic
930300099 2:49604722-49604744 AATTTAGGACTCCCAAAATTGGG + Intergenic
931027378 2:58127272-58127294 ATTTTCGTGCTACCAAACTTGGG + Intronic
932343395 2:70980433-70980455 GTACTCTGGCTCCCAAACTTAGG + Intronic
939565399 2:143781139-143781161 ATTTTAGGGCTTCCAAAATTTGG - Intergenic
940159245 2:150693675-150693697 GTTTTCATGCTCCCATACTTAGG - Intergenic
940694185 2:156958803-156958825 CTTTTAGGGATCCCAGACTTAGG - Intergenic
941106104 2:161354925-161354947 GCTGTAGGGCCACCAAACTTAGG + Intronic
941671091 2:168293666-168293688 ATTTTGGGGGTCACAAACTTGGG + Intergenic
943595221 2:189847525-189847547 GTTTTATGGATACAAAACTTGGG + Intronic
943606478 2:189983180-189983202 GTTGCAGGGCTCACAACCTTCGG + Intronic
944505174 2:200403646-200403668 ATTTTAGGGCTCAGAAACATAGG - Intronic
945752888 2:213810349-213810371 GTATGAGGTCTCCCAAATTTTGG + Intronic
949013386 2:241695154-241695176 GTCTTAGGGCTACCAAAGTGAGG + Intergenic
1169939580 20:10922810-10922832 GTTTCCCTGCTCCCAAACTTGGG + Intergenic
1176332049 21:5558308-5558330 GTTTTTGGGTTCCCAAGATTGGG - Intergenic
1176395708 21:6262643-6262665 GTTTTTGGGTTCCCAAGATTGGG + Intergenic
1176441449 21:6726461-6726483 GTTTTTGGGTTCCCAAGATTGGG - Intergenic
1176465711 21:7053530-7053552 GTTTTTGGGTTCCCAAGATTGGG - Intronic
1176489272 21:7435308-7435330 GTTTTTGGGTTCCCAAGATTGGG - Intergenic
1177037320 21:16060317-16060339 CTTTCAGGGATCCCAGACTTAGG - Intergenic
1179089178 21:38247987-38248009 GTGTTATTGCTTCCAAACTTGGG + Intronic
1184525248 22:45018993-45019015 GTTTTGGGGATCCCAGACCTGGG - Intergenic
1184751591 22:46489430-46489452 GGTTTGGGGCCCCCAAGCTTGGG - Intronic
951406579 3:22307106-22307128 CTTTTAGGGCGCAGAAACTTTGG - Intronic
959524131 3:107357110-107357132 GGTTGAGGCCTCCCAAATTTGGG + Intergenic
960446436 3:117754979-117755001 GGTTGAGTACTCCCAAACTTTGG - Intergenic
963936570 3:151060126-151060148 GTTTTTGAGCTTCCAAACTGGGG + Intergenic
964150076 3:153513399-153513421 GTTTCAGAGCTTCCTAACTTGGG - Intergenic
965246214 3:166273326-166273348 GTTTTAAGCCTCCCAAGTTTTGG + Intergenic
965720986 3:171661977-171661999 ATTTCAGGGTCCCCAAACTTAGG - Intronic
966417078 3:179700534-179700556 GTTTTAGAGTTGACAAACTTAGG - Intronic
969368111 4:6711988-6712010 GTTTTAAAGCTGCCAAATTTTGG - Intergenic
975319023 4:72988879-72988901 GTTTTGGTGCTCCAAAGCTTTGG + Intergenic
988005267 5:25402335-25402357 GTTTTAAGGCTTTCAGACTTGGG + Intergenic
990076273 5:51849583-51849605 GTTTTCTGGCTTCCAAACCTGGG - Intergenic
990815169 5:59776539-59776561 CTTTTATGGCTCTGAAACTTGGG + Intronic
991057808 5:62338621-62338643 GTTTTAGGGATCTCAATCTTAGG + Intronic
992077410 5:73204045-73204067 GATCAAGGGTTCCCAAACTTGGG + Intergenic
994849705 5:105038423-105038445 GTTTTAGGTCTCCAAATATTTGG - Intergenic
997356953 5:133268662-133268684 GTTTTATGGTTTCCAAAGTTAGG - Intronic
999428827 5:151508980-151509002 GTTTTAGGGCTCCCAAACTTGGG - Intronic
1002594724 5:180314511-180314533 GCTTTAGGACTCACAAACATAGG - Intronic
1004089720 6:12488661-12488683 ATCTTATGGCTTCCAAACTTTGG + Intergenic
1007383636 6:41505694-41505716 GTCTTAGGGCTCCCACGCTCTGG + Intergenic
1010484876 6:76398321-76398343 CTTTTAGTGCTAACAAACTTTGG - Intergenic
1017432027 6:154380995-154381017 GTGATAGGGCTCCCTAACTGAGG - Intronic
1018593795 6:165456002-165456024 GTTTGAGGTCACCAAAACTTAGG + Intronic
1026609643 7:71846236-71846258 GTTTCAGCTTTCCCAAACTTTGG - Intronic
1030724917 7:112916127-112916149 TTTTTAAGGCTTACAAACTTTGG - Intronic
1031871663 7:127094649-127094671 GGTTTCTGGCTCCCAAACTGTGG + Intronic
1032519047 7:132528807-132528829 GTTTTAGAGCCGCCCAACTTGGG + Intronic
1042919786 8:73909771-73909793 GTTTTTGTGCTCCTAAAATTGGG - Intergenic
1046566144 8:115903777-115903799 TTTTTATGGCTCCCAAATTTGGG - Intergenic
1051586966 9:18736897-18736919 GTTTTGGGGCTCCCAAAATGTGG - Intronic
1052655160 9:31349720-31349742 GTTTGTGAGCTCCCTAACTTAGG + Intergenic
1061360192 9:130136628-130136650 TTTTTCAGGTTCCCAAACTTGGG - Exonic
1187261521 X:17688888-17688910 GTTTTAGAGCCCCCTAAATTGGG + Intronic
1196071267 X:111525148-111525170 GTTTAAGGGTTCTCAAACTAAGG + Intergenic
1196458245 X:115904830-115904852 AATGTAGTGCTCCCAAACTTTGG + Intergenic
1199802292 X:151263499-151263521 GTTTTAAGGCTCTCAAGGTTAGG - Intergenic
1200229291 X:154436250-154436272 GTTATAGGGCTCCCTGAGTTTGG + Exonic
1201699373 Y:16863416-16863438 GTTTTATGTCTGCCAAGCTTTGG + Intergenic
1202181601 Y:22144519-22144541 TTTTTAAGTCTCCCAACCTTTGG - Intergenic
1202209759 Y:22441881-22441903 TTTTTAAGTCTCCCAACCTTTGG + Intergenic