ID: 999428827

View in Genome Browser
Species Human (GRCh38)
Location 5:151508980-151509002
Sequence GTTTTAGGGCTCCCAAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999428827_999428833 17 Left 999428827 5:151508980-151509002 CCCAAGTTTGGGAGCCCTAAAAC 0: 1
1: 0
2: 1
3: 10
4: 106
Right 999428833 5:151509020-151509042 CTCTTTCTCTCTAGGATTCTAGG 0: 1
1: 0
2: 1
3: 42
4: 372
999428827_999428832 9 Left 999428827 5:151508980-151509002 CCCAAGTTTGGGAGCCCTAAAAC 0: 1
1: 0
2: 1
3: 10
4: 106
Right 999428832 5:151509012-151509034 GTCAAAGTCTCTTTCTCTCTAGG 0: 1
1: 0
2: 1
3: 37
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999428827 Original CRISPR GTTTTAGGGCTCCCAAACTT GGG (reversed) Intronic