ID: 999428833

View in Genome Browser
Species Human (GRCh38)
Location 5:151509020-151509042
Sequence CTCTTTCTCTCTAGGATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 372}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999428827_999428833 17 Left 999428827 5:151508980-151509002 CCCAAGTTTGGGAGCCCTAAAAC 0: 1
1: 0
2: 1
3: 10
4: 106
Right 999428833 5:151509020-151509042 CTCTTTCTCTCTAGGATTCTAGG 0: 1
1: 0
2: 1
3: 42
4: 372
999428829_999428833 3 Left 999428829 5:151508994-151509016 CCCTAAAACCAGATAATTGTCAA 0: 1
1: 0
2: 0
3: 14
4: 229
Right 999428833 5:151509020-151509042 CTCTTTCTCTCTAGGATTCTAGG 0: 1
1: 0
2: 1
3: 42
4: 372
999428828_999428833 16 Left 999428828 5:151508981-151509003 CCAAGTTTGGGAGCCCTAAAACC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 999428833 5:151509020-151509042 CTCTTTCTCTCTAGGATTCTAGG 0: 1
1: 0
2: 1
3: 42
4: 372
999428830_999428833 2 Left 999428830 5:151508995-151509017 CCTAAAACCAGATAATTGTCAAA 0: 1
1: 0
2: 3
3: 18
4: 417
Right 999428833 5:151509020-151509042 CTCTTTCTCTCTAGGATTCTAGG 0: 1
1: 0
2: 1
3: 42
4: 372
999428831_999428833 -5 Left 999428831 5:151509002-151509024 CCAGATAATTGTCAAAGTCTCTT 0: 1
1: 0
2: 1
3: 19
4: 207
Right 999428833 5:151509020-151509042 CTCTTTCTCTCTAGGATTCTAGG 0: 1
1: 0
2: 1
3: 42
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999428833 Original CRISPR CTCTTTCTCTCTAGGATTCT AGG Intronic