ID: 999431965

View in Genome Browser
Species Human (GRCh38)
Location 5:151532038-151532060
Sequence CTGCAGCCACAGGAGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 7, 3: 64, 4: 598}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999431954_999431965 5 Left 999431954 5:151532010-151532032 CCTCCTCTGGACCTGCCTGCAGC 0: 1
1: 0
2: 5
3: 52
4: 336
Right 999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG 0: 1
1: 0
2: 7
3: 64
4: 598
999431952_999431965 19 Left 999431952 5:151531996-151532018 CCACACTGAGGGCGCCTCCTCTG 0: 1
1: 0
2: 7
3: 32
4: 214
Right 999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG 0: 1
1: 0
2: 7
3: 64
4: 598
999431956_999431965 -6 Left 999431956 5:151532021-151532043 CCTGCCTGCAGCAAACCCTGCAG 0: 1
1: 1
2: 4
3: 46
4: 298
Right 999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG 0: 1
1: 0
2: 7
3: 64
4: 598
999431955_999431965 2 Left 999431955 5:151532013-151532035 CCTCTGGACCTGCCTGCAGCAAA 0: 1
1: 0
2: 0
3: 19
4: 247
Right 999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG 0: 1
1: 0
2: 7
3: 64
4: 598
999431957_999431965 -10 Left 999431957 5:151532025-151532047 CCTGCAGCAAACCCTGCAGCCAC 0: 1
1: 0
2: 4
3: 34
4: 325
Right 999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG 0: 1
1: 0
2: 7
3: 64
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999431965 Original CRISPR CTGCAGCCACAGGAGGGGCT GGG Intronic
900203689 1:1422101-1422123 GTGCAGCCGCTGGAGGGGCCAGG - Intergenic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900280375 1:1863438-1863460 CTGCTGCCACTGGAGGGGTTTGG + Intronic
900302762 1:1986269-1986291 CTGCAGCCTCCGGAGTAGCTGGG - Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900494711 1:2971220-2971242 CTGCCCCCACAGGAGGGGCTGGG - Intergenic
900600667 1:3501454-3501476 CTGCAGCCCCAGGAGGTGCCCGG - Intronic
900650791 1:3729244-3729266 CCGCAGCCTCAGGAGGACCTGGG - Intronic
900726211 1:4218012-4218034 CTGCAGCCACAGGCGGAACCAGG - Intergenic
900737330 1:4307365-4307387 GGGCAGACACAGAAGGGGCTTGG - Intergenic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901062050 1:6476068-6476090 CTGCAGGCTAAGGAGGGGCGGGG - Intronic
901198001 1:7451086-7451108 CTGGAGCCTCAGCAGGGTCTGGG - Intronic
901213953 1:7543379-7543401 CTGCAGCCACAAGTGCTGCTGGG - Intronic
901388917 1:8929933-8929955 CCTTAGCCACAAGAGGGGCTGGG + Intergenic
901498819 1:9638889-9638911 CCTCAGCCTCAGGAGGAGCTGGG + Intergenic
902552798 1:17229292-17229314 CTGCAGCCACAGGACAGGATGGG - Intronic
902658584 1:17886264-17886286 CTGCAGCCCCTGGAGGGGCCTGG + Intergenic
902722016 1:18310046-18310068 ATGCAGCCACAGGCGGGACTGGG - Intronic
902839618 1:19066801-19066823 CTTCACCCAAAGGAGGGGCTTGG - Intergenic
903036167 1:20493992-20494014 CTGCAGCATTAGGAGGGGCTGGG + Intergenic
903312499 1:22470712-22470734 CTGGAGCCACAGAAGAGTCTAGG + Intronic
903657860 1:24959890-24959912 CGGGAGCCACAGGGAGGGCTGGG - Intronic
903968244 1:27102813-27102835 CTGCAGCTACGGGAGGGAGTGGG - Intronic
904379874 1:30103421-30103443 GGGCCGCCCCAGGAGGGGCTGGG - Intergenic
904396782 1:30227638-30227660 CTGTAGACCTAGGAGGGGCTTGG - Intergenic
905028613 1:34867037-34867059 CTGGAGCCTAAGGTGGGGCTGGG - Exonic
905172093 1:36115373-36115395 CAGCGGCAGCAGGAGGGGCTGGG + Intronic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
907284955 1:53373716-53373738 CTGCAGCCACACCGAGGGCTGGG + Intergenic
907481517 1:54748405-54748427 CTGCTGCCGCAGCAGGGCCTAGG - Intergenic
907826067 1:58017887-58017909 CTGCAGCCTCAAGGAGGGCTGGG - Intronic
908253878 1:62286752-62286774 CTGGGGCCCCAGGAGGGGGTAGG - Intronic
908339235 1:63159425-63159447 CTGGAGCCTTTGGAGGGGCTGGG + Intergenic
908383373 1:63617410-63617432 CTGCAGCCACAGGCAGTGGTGGG + Intronic
910166921 1:84337594-84337616 CTGCCATCACAGGAGGGCCTAGG - Intronic
910342478 1:86203435-86203457 CTGCAGTCACAGGACGAGCAGGG - Intergenic
911139040 1:94477508-94477530 CTGCAGCCTCTGGAGTAGCTGGG - Intronic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912565199 1:110582491-110582513 CTTCTGCCAAAGGAGGGGCTGGG + Intergenic
913147978 1:116011118-116011140 CAGCAGCCAGCTGAGGGGCTAGG + Intronic
913249545 1:116901152-116901174 CTGCAGCACAAGGATGGGCTAGG + Intergenic
915706809 1:157851679-157851701 CTGCAGCCTCAGGAAGGCCTAGG - Intronic
916145542 1:161735836-161735858 CTGCAGCCCCCTGAGGAGCTGGG - Intergenic
916217703 1:162411643-162411665 CTGCAGCAGCAGGAGGGACATGG - Intronic
918154992 1:181836055-181836077 CTGCAGCTACTGGTGGGGATAGG - Intergenic
918211949 1:182359016-182359038 CTTCAGCCACCTGAGGAGCTAGG + Intergenic
918434230 1:184494998-184495020 CTGCAGTCCCAGGAGGTTCTAGG - Intronic
920513326 1:206566611-206566633 CTCCAGCCAACGGAGGGGATAGG - Intronic
920717037 1:208349832-208349854 AGGCAGGCAGAGGAGGGGCTGGG + Intergenic
921181592 1:212635959-212635981 CTGCAGTAAATGGAGGGGCTTGG + Intergenic
922063932 1:222117760-222117782 CTCCAGTCCCAGGAGGGACTTGG - Intergenic
922744895 1:228038206-228038228 CTGCGGCCCCAGGAGGAGCCAGG - Intronic
923557126 1:235010008-235010030 AGGCAGCCACAGGCAGGGCTTGG + Intergenic
924801621 1:247332332-247332354 CCGCAGCGGCAGGAGGGGCTGGG - Intergenic
1062971689 10:1653603-1653625 CTGCAGGCACAGAAGGCGTTGGG - Intronic
1062971695 10:1653640-1653662 CTGCAGGCACAGAAGGTGTTGGG - Intronic
1063980557 10:11448397-11448419 CTACAGCCCGAGGTGGGGCTGGG + Intergenic
1064195578 10:13241561-13241583 CTGCAGCCTCCCGAGGAGCTGGG + Intergenic
1064409715 10:15094423-15094445 CCTCAGCCTCAGGAGTGGCTGGG + Intergenic
1064456365 10:15490981-15491003 CTGCAGGCCCAGGAGATGCTTGG + Intergenic
1067042466 10:42962309-42962331 CTGCTGCATCAGGAGGGGCCAGG + Intergenic
1067281821 10:44879186-44879208 CTCCAGGCTGAGGAGGGGCTCGG - Intergenic
1067298640 10:44990571-44990593 CTCCAGGCTGAGGAGGGGCTCGG + Intronic
1067525521 10:47036091-47036113 CTCCAGTCACAGGAGGTCCTTGG - Intergenic
1067564568 10:47327256-47327278 CTCCAGCCAGAGCAGGGCCTAGG + Intergenic
1067716421 10:48694336-48694358 ATAAAGCCACAGGAGAGGCTGGG - Intronic
1068533008 10:58210100-58210122 CTGCAGCCACTGTGGGGGATGGG + Intronic
1068649703 10:59508492-59508514 TTGCAGCCACAGGTGGGGTGGGG + Intergenic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069338677 10:67385244-67385266 CTGGAGCCACAGGAGGCCCTGGG - Intronic
1069622450 10:69846264-69846286 CTGGTGGCACTGGAGGGGCTGGG + Intronic
1069696739 10:70392019-70392041 CTGAAGCAACAGGAGTGGGTAGG + Intergenic
1069838686 10:71325807-71325829 CTTCAGTCACCCGAGGGGCTTGG - Intronic
1069994096 10:72332191-72332213 GTGCAGCCGCGGGAGGGGCCTGG + Intergenic
1070623170 10:78029468-78029490 AAGCAGCCCCAGGAGGTGCTGGG - Exonic
1071287864 10:84165538-84165560 CAGCAGCCACAGCAGAGGATAGG - Intergenic
1071529894 10:86381043-86381065 CTGCAGCCACAGGTGGCCCAAGG - Intergenic
1072310508 10:94149828-94149850 CTTCAGAGACAGCAGGGGCTGGG + Intronic
1072515436 10:96176960-96176982 CTGCAGCCACTGAAGTAGCTGGG - Intronic
1072517362 10:96198812-96198834 CTTCAGCCTCCGGAGGAGCTGGG + Intronic
1073206032 10:101769925-101769947 CTGCACCCCCAGGTGGGGCAGGG - Intergenic
1074011919 10:109490777-109490799 CTGCAGCCACCAGAGTAGCTGGG - Intergenic
1074532216 10:114305519-114305541 GTGCAGGTACAGGAGGGGTTGGG + Intronic
1075015221 10:118905727-118905749 ATGCAGGCAGAGGAGGGGCTTGG + Intergenic
1075148160 10:119901121-119901143 CTTCAGCCTCAGGAGTAGCTGGG + Intronic
1075201648 10:120409468-120409490 CTGCAGCCACAGGTCCAGCTGGG - Intergenic
1075715669 10:124553834-124553856 CTGCAGACAGAGGAGGGGCCTGG - Intronic
1075815193 10:125259736-125259758 CTGCACCCACAGGAGGGGCAGGG + Intergenic
1076132352 10:128022205-128022227 CTGCCGACTCAGGAGGGGCCTGG - Intronic
1076307734 10:129476690-129476712 CTGCAGCCCCAGCATGGCCTTGG - Intronic
1076379196 10:130013869-130013891 CTGCATCCTCCGGATGGGCTCGG - Intergenic
1076539984 10:131207696-131207718 CTGCAGCAAGAGGAGGGGTGTGG + Intronic
1076737742 10:132466259-132466281 CTGTGGCCACAGGAGGGGCCCGG - Intergenic
1076744896 10:132507922-132507944 CTGGAGCCACAGCAGGGTCACGG + Intergenic
1076768917 10:132652355-132652377 CTGCAGCCCCAGGAGGAGCGGGG + Intronic
1076903511 10:133351287-133351309 ATGCAGCCCCAGGTGGGCCTCGG + Intronic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077063350 11:627114-627136 CAGCAGCAGCAGGAGGGGCCGGG + Exonic
1077252621 11:1567286-1567308 CCACAGCCACAGGAGGCACTGGG + Intronic
1077256903 11:1589293-1589315 CAGCTGACACCGGAGGGGCTGGG - Intergenic
1077353730 11:2105084-2105106 CTGCAGCCACATGATGGCCGAGG - Intergenic
1077461703 11:2714093-2714115 CCCCAGCAACAGGAGAGGCTCGG - Intronic
1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG + Intronic
1077538209 11:3134510-3134532 CAGCAGCAGGAGGAGGGGCTGGG - Intronic
1078436154 11:11327613-11327635 CTGCAGACCCAGCAGTGGCTTGG + Intronic
1078706232 11:13746800-13746822 ATGAAGCCACAGGCAGGGCTGGG + Intergenic
1079032973 11:16999327-16999349 CTGCAGGCAGAGGAGGGCCTGGG - Intronic
1080290842 11:30669903-30669925 CTGTAGCAAAAGGTGGGGCTAGG - Intergenic
1080653725 11:34242430-34242452 ACGCAGCCACAGGAGGGGCAGGG + Intronic
1081570208 11:44286102-44286124 CTCCAGACACAGGAGGTCCTTGG + Intronic
1081814130 11:45929176-45929198 CTGGGGTCACAGGAGGGCCTGGG + Intergenic
1081901029 11:46627965-46627987 CTTCAGCCTCAGGAGTAGCTGGG - Intronic
1082008726 11:47436320-47436342 CTTCAGCCTCCGGAGGAGCTGGG + Intergenic
1082691352 11:56308360-56308382 CTGGAGCCACAGGAAAAGCTGGG + Intergenic
1082866454 11:57904026-57904048 CTGCAGACACATGAGGTGGTTGG - Intergenic
1083233001 11:61334926-61334948 CTGCAGCCCCAGGCCTGGCTGGG - Intronic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083628055 11:64082114-64082136 GCGCAGCCACAGGAGGGCCTGGG - Intronic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1083831423 11:65236316-65236338 GTGGAGCCTCAGGAGGGGATAGG - Intergenic
1084269212 11:68020110-68020132 CTGCAGGCAGATGAGGGACTGGG + Intronic
1084332443 11:68438041-68438063 CACCAGCCACGGGAGGGGCAGGG - Intronic
1084399883 11:68937347-68937369 CTGCAGCAGCAGGAGGGGCCTGG + Intronic
1084412510 11:69012856-69012878 CTGGAGCCTCAGGAGTGGCAGGG + Intronic
1084562952 11:69914404-69914426 CTGCAGCCAGGGAGGGGGCTGGG + Intergenic
1084884713 11:72196092-72196114 CTGCAGCCATGAGTGGGGCTGGG + Exonic
1084941221 11:72614458-72614480 CTCTAGCCACAGGAGGTGCTTGG - Intronic
1085224762 11:74909662-74909684 AAACTGCCACAGGAGGGGCTCGG - Intronic
1085280235 11:75325266-75325288 GGGCAGCCAGAGTAGGGGCTGGG - Intronic
1086013641 11:82137502-82137524 CTGGAGCCAAAGAAAGGGCTGGG + Intergenic
1088884626 11:113997230-113997252 CTGCCTCTACAGGAGAGGCTTGG - Intergenic
1089329590 11:117680322-117680344 CTGCACCCACAGGAGGGTCAGGG - Intronic
1089573324 11:119423779-119423801 CTGCAGCCCCCTGAAGGGCTGGG - Exonic
1089890299 11:121874028-121874050 CTGCAGCCAGAGGGGCAGCTGGG + Intergenic
1090099455 11:123778764-123778786 CTGCAGCTGCAGGAGAAGCTGGG - Intergenic
1090239722 11:125173633-125173655 CTTCAGTCTCAGGTGGGGCTGGG + Intronic
1090387996 11:126367557-126367579 CCGCAGCCTCAGCAGGGGCTAGG - Intronic
1090390634 11:126385003-126385025 CCGCAGCCTCAGCAGGGGCTGGG - Intronic
1090398622 11:126434814-126434836 CACAAGCCACAGCAGGGGCTGGG + Intronic
1091121366 11:133060602-133060624 ATGCAGCCACAGTAGGAGCAGGG - Intronic
1091545171 12:1496737-1496759 CTGCAGCCACAGCAGCTGTTGGG + Intergenic
1091601122 12:1918303-1918325 CAGCAGCCACAGGAGGGCCGAGG + Exonic
1091603736 12:1933639-1933661 CAGCAGCCAAAGGAAAGGCTTGG + Intergenic
1091658393 12:2362734-2362756 CTGCAGCCACAGGAGAGAGAGGG - Intronic
1091679479 12:2516517-2516539 CTGCTGCCTCAGGAGATGCTGGG + Intronic
1092018827 12:5183069-5183091 CTGCAGACAGAGGCTGGGCTTGG - Intergenic
1092141143 12:6184324-6184346 TTGCAGACAGAGGAGGGGCCAGG - Intergenic
1093692640 12:22125266-22125288 TTTCAGCCACAGGAGTGCCTGGG - Intronic
1095225797 12:39675239-39675261 CTGCAGCCACTGTGGGGGATGGG - Intronic
1096741549 12:53697327-53697349 CTGCAGCCTGAGTCGGGGCTGGG + Intergenic
1098266219 12:68723252-68723274 CTTCAGCCTCTGGAGGAGCTGGG - Intronic
1099874982 12:88393061-88393083 CTGCATCCACAGCAGTGGATGGG - Intergenic
1101145639 12:101838200-101838222 CTGCAGCCCCTGGAGTAGCTGGG + Intergenic
1102103181 12:110297317-110297339 CTGCAGCCTCACAAGTGGCTGGG - Intronic
1102526485 12:113515715-113515737 CAGCGGCCACAGCAGGAGCTGGG + Intergenic
1103933360 12:124462372-124462394 CTGCAGCCAGCGGAGGGGCTTGG - Intronic
1103980668 12:124734963-124734985 CAGGAGCCTCAGGAGGGCCTGGG + Intergenic
1104729441 12:131096990-131097012 CTGCAGCCACAGCAGAGGCGTGG - Intronic
1104947627 12:132423623-132423645 CTGCAGGCGGAGCAGGGGCTGGG + Intergenic
1104952208 12:132446296-132446318 CGTCATCCACAGGAGCGGCTGGG - Intergenic
1106168509 13:27269882-27269904 CTGCCTGCAGAGGAGGGGCTGGG + Intergenic
1106209870 13:27631963-27631985 CTGAAGCCACAGGATAGGCATGG - Intronic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1106699248 13:32211341-32211363 CTGCAGCCTCCTGAGGAGCTGGG - Intronic
1107414542 13:40188537-40188559 CTGAAGCCACAGGAGGGGAAGGG + Intergenic
1107885627 13:44872281-44872303 CTGCTGGGACACGAGGGGCTGGG + Intergenic
1110568611 13:76980388-76980410 CTGCAGCCTCCGCAGGGGCCGGG - Intergenic
1112040919 13:95547134-95547156 CCTCAGCCTCTGGAGGGGCTGGG + Intronic
1112622223 13:101064670-101064692 CAGCAGCCAGGGGAGAGGCTAGG + Intronic
1112671433 13:101643720-101643742 CTGGATCCACTGTAGGGGCTGGG + Intronic
1113370950 13:109725023-109725045 CTGCATTCACAGGCTGGGCTGGG + Intergenic
1113480188 13:110615070-110615092 CATCAGCCACAGGAGGAGCGTGG + Intergenic
1113625460 13:111793064-111793086 CTGCAGGTACAAGAGAGGCTGGG - Intergenic
1113651505 13:112036838-112036860 ATGCAGCCCCAGGAGAGACTAGG - Intergenic
1113945731 13:114043110-114043132 TTGCAGACAAAGGAGGGGCCTGG - Intronic
1116828347 14:49693417-49693439 CGGCGGCCAGCGGAGGGGCTGGG - Intronic
1117035420 14:51723048-51723070 CTGCAGCTACAGGCAGGTCTGGG - Intronic
1118009524 14:61595345-61595367 CTGCAGCCGCAAGAGTGACTTGG + Intronic
1118437481 14:65784837-65784859 CTCCAGCCCCAGGAGGGATTGGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119731263 14:76952775-76952797 CTGCAGCCTCATGAGTAGCTGGG - Intergenic
1119738832 14:77000756-77000778 CTGCAGGGATAGGAGGGGCCCGG - Intergenic
1119852330 14:77874976-77874998 GTCCAGGGACAGGAGGGGCTTGG + Intronic
1119919960 14:78437637-78437659 CGGAAACCACAGGATGGGCTGGG - Intronic
1121043744 14:90773084-90773106 CTTCAGGGACAGGAGGGGCAAGG + Intronic
1121417542 14:93789242-93789264 CCGCAGCCTCGGGAGAGGCTTGG - Intergenic
1122005110 14:98697015-98697037 CTGGGGCCACAGGTGGGGGTGGG + Intergenic
1122282891 14:100634654-100634676 CTGCTGCTACAGGTGGGCCTTGG - Intergenic
1122454336 14:101838549-101838571 CTGAAGGTAAAGGAGGGGCTGGG - Intronic
1122717071 14:103702237-103702259 CTGCAGACACTGGCTGGGCTTGG - Intronic
1122783703 14:104154423-104154445 CTGCGGCCACAGGTGGGGCCTGG + Intronic
1122797969 14:104215929-104215951 CTGGAGCCACATGAGGAGGTAGG - Intergenic
1122830959 14:104395512-104395534 CAGCAAACAGAGGAGGGGCTGGG + Intergenic
1122834805 14:104425401-104425423 CTGCAGCACCGGGAGGGTCTTGG + Intergenic
1122919195 14:104873129-104873151 CTGCAGTCTGGGGAGGGGCTTGG + Intronic
1123846371 15:24306650-24306672 CTGCAGCCTCCAGAGGAGCTGGG + Intergenic
1123972926 15:25525889-25525911 CTCCAGCCTCAGGAAGTGCTGGG - Intergenic
1125726302 15:41870015-41870037 CTGCAGCTGCGGGAGGGGCAGGG + Exonic
1126938024 15:53733436-53733458 ATGTAGCCACAGGAAGAGCTGGG - Intronic
1127099380 15:55549547-55549569 TTGCAGCAACAGCAGAGGCTTGG - Intronic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128260001 15:66226732-66226754 CAGCATCCACTGGGGGGGCTTGG + Intronic
1128538080 15:68505497-68505519 GTGCACCCATAGGAGGGTCTAGG + Intergenic
1128776406 15:70323625-70323647 CTGCAGACAGAGGCAGGGCTTGG - Intergenic
1129389758 15:75214662-75214684 CAGGAGAGACAGGAGGGGCTTGG - Intergenic
1129421407 15:75430249-75430271 CTTCATACACAGGAGGGGCAGGG + Exonic
1130660035 15:85824106-85824128 CTGCAGTCCCTGGAGGAGCTGGG + Intergenic
1130717754 15:86352595-86352617 CTGCAGTCTCCCGAGGGGCTGGG + Intronic
1131050065 15:89341847-89341869 CAGCAGTCCCAGGAGTGGCTGGG + Intergenic
1131217600 15:90552117-90552139 CTGCTGCCACAGCAGGCGCTCGG - Intronic
1131505415 15:93013817-93013839 CTTCAGCCTCCTGAGGGGCTGGG - Intronic
1132548724 16:545435-545457 CTCCAGCCACAGAAGGGCCGTGG + Intronic
1132587270 16:711013-711035 CTGCAGCCTGAGGGGGTGCTGGG - Intronic
1132630238 16:913798-913820 CTGCAGCCACCGGAGGCGTGGGG + Intronic
1132684008 16:1154703-1154725 CTCCAGCCAGGGAAGGGGCTGGG - Intronic
1132702754 16:1229082-1229104 GTGCAGCCTCAGGAGGGGGCCGG + Intronic
1132705572 16:1241786-1241808 GTGCAGCCTCAGGAGGGGGCCGG - Intronic
1132806726 16:1778400-1778422 GTGCAGTCCCAGCAGGGGCTGGG + Intronic
1132809787 16:1792059-1792081 CTGGAGCCACAGGCGCTGCTGGG - Exonic
1133871313 16:9689089-9689111 CCTCAGCCACAGGAGTAGCTGGG + Intergenic
1134041577 16:11072978-11073000 CTGAAACCACAGGATGGGGTGGG + Intronic
1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG + Intronic
1135052868 16:19206635-19206657 CAGAAGCCACAGGAGAGGCCTGG - Intronic
1135554898 16:23428059-23428081 CTGCAGCCTCTGGAGTAGCTGGG - Intronic
1135767645 16:25191691-25191713 CTACAGCAACAGGATGGGCATGG + Intergenic
1136280241 16:29204105-29204127 CAGCAGCCACAAGTGGGACTCGG - Intergenic
1137039614 16:35598889-35598911 CTCCTGCCACAAGTGGGGCTGGG + Intergenic
1137774724 16:51045387-51045409 CAGCAGCCTCATGAAGGGCTTGG + Intergenic
1137978169 16:53048288-53048310 CTGCAGCCACTGTAGTAGCTGGG - Intergenic
1138189954 16:55006758-55006780 CTGGAGCCACAGGAAGGGAATGG + Intergenic
1138212589 16:55175773-55175795 CTGCAGATTCAGGAGGGGATGGG + Intergenic
1138415620 16:56869915-56869937 CCGGAACCACAGGAGCGGCTGGG - Intronic
1138608659 16:58105737-58105759 CTGCAGACAGAGGAGGGGCCAGG - Intergenic
1139642019 16:68298581-68298603 CTGCAGTCTCAGGAAGAGCTTGG + Exonic
1139800616 16:69519754-69519776 CTTCAGCCACCGGAGTAGCTGGG + Intergenic
1139811431 16:69621845-69621867 CTGCAGCCTCCCGAGTGGCTGGG - Intronic
1139922789 16:70470436-70470458 CAGCAGGCACCGGAGGGGCAGGG - Intronic
1140533583 16:75688911-75688933 CCACAGCCACATGAGTGGCTGGG + Intronic
1140541143 16:75757437-75757459 GTGGAGTCACAGGAGGTGCTTGG + Intronic
1140629344 16:76832961-76832983 CTGCAGCCACTGGGGTGGCTTGG + Intergenic
1141668753 16:85480487-85480509 CTGCAGTCACAGGAGTGTCGAGG - Intergenic
1141713362 16:85713145-85713167 CAGAAGCCAGGGGAGGGGCTTGG - Intronic
1142003204 16:87675789-87675811 CTTCTGACCCAGGAGGGGCTGGG + Intronic
1142025482 16:87810625-87810647 CTGCAGCCCCAGGTGGACCTTGG + Intergenic
1142084603 16:88170047-88170069 CAGCAGCCACAAGCGGGACTCGG - Intergenic
1142112192 16:88338862-88338884 CTGGAGCCTCAGGAGGAGCGTGG + Intergenic
1142124849 16:88405172-88405194 TTGCAGCCACAGGATGGGCCAGG + Intergenic
1142128303 16:88420992-88421014 CAGAGGCCCCAGGAGGGGCTGGG + Intergenic
1142147956 16:88500262-88500284 CGGCAGGCCCAGGAGGGGCAAGG - Intronic
1142274228 16:89107816-89107838 ATGCAGCCACATTTGGGGCTGGG - Intronic
1142307991 16:89296102-89296124 CTTCAGCCTCAGGAGTAGCTGGG + Intronic
1142373187 16:89694256-89694278 CTGGGGCCTCAGGAAGGGCTGGG + Intronic
1142433049 16:90040804-90040826 CTGAGTCCACAGGTGGGGCTGGG + Intronic
1142615329 17:1130889-1130911 CGGCAGCCTGGGGAGGGGCTGGG + Intronic
1143516683 17:7422764-7422786 CTGCAGCCACCGGTGAGGCCTGG + Intergenic
1143624257 17:8099947-8099969 CCTCAGCTACAGGAGAGGCTGGG + Intronic
1144483009 17:15642982-15643004 CTGCAGCCCCAGGAGGGCACGGG - Intronic
1144638147 17:16923926-16923948 CTGCAACCACACGACGGGCCTGG - Intergenic
1144831953 17:18136764-18136786 CTGCAGGCACAGAAAGGGATGGG - Intronic
1144915673 17:18722049-18722071 CTGCAGCCCCAGGAGGGCACGGG + Intronic
1144956062 17:19019528-19019550 CTGCAGTCACTGGTGGGGCCAGG - Exonic
1145002521 17:19315196-19315218 CACCAGCCAAAGGAGGGGCTGGG - Intronic
1145187006 17:20803482-20803504 CTGCAGCCTCCGGAGTAGCTGGG - Intergenic
1145269678 17:21398040-21398062 CTGCAGCCACTGCCAGGGCTGGG + Intronic
1145734682 17:27219542-27219564 CTCCAGGCCCAGGAGGAGCTAGG - Intergenic
1145907326 17:28523680-28523702 TAGGAGCCTCAGGAGGGGCTTGG - Intronic
1146370250 17:32261686-32261708 CTGCAGAGAGAGAAGGGGCTCGG + Intergenic
1147649096 17:42051777-42051799 CAGCAGCCACTGGTGGGGCTGGG - Intronic
1147900162 17:43778659-43778681 CGGGAGCCACAGCGGGGGCTTGG - Intronic
1148208943 17:45796579-45796601 CTGCAGTAACTGGAGGGACTGGG - Intronic
1148733390 17:49851276-49851298 CTGCCGCCAGAGGAGGGACCCGG + Intergenic
1149517751 17:57293212-57293234 CTGGGGCCACAGGGGAGGCTGGG + Intronic
1149557942 17:57587563-57587585 CTGCAGCCACCTTTGGGGCTGGG - Intronic
1150246059 17:63676255-63676277 CTACAGACCCAGGAGGGTCTGGG - Intronic
1150496406 17:65611228-65611250 CTGCAGCTAGAACAGGGGCTAGG + Intronic
1150913741 17:69414728-69414750 CTGCAGCTACATGATGGGCCAGG - Exonic
1151069691 17:71194821-71194843 ATTCAGCCAAAGGAGAGGCTTGG - Intergenic
1151342512 17:73481067-73481089 CAGCAGCCTCAGGAGGGGAAGGG + Intronic
1151460838 17:74253180-74253202 CTGCAGCTACAGCAGTGGCCTGG + Exonic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1152442661 17:80318402-80318424 CCCCAGGCACAGGAGGGGCCAGG + Intronic
1154017122 18:10628486-10628508 CAGCACCCTCAGGAGGAGCTAGG + Intergenic
1154107376 18:11534249-11534271 CTGCGGCCACAGCAAGGGCACGG + Intergenic
1154187737 18:12201117-12201139 CAGCACCCTCAGGAGGAGCTAGG - Intergenic
1154218240 18:12431434-12431456 CTGCAGGGAGAGAAGGGGCTGGG - Exonic
1155166722 18:23237836-23237858 CTGCAGACACCAGAGGGGCCTGG + Intronic
1155221335 18:23689054-23689076 CTGCAGCCACAGGCTGAGCCAGG - Intergenic
1155409834 18:25531810-25531832 CTGGAGCCACAGGAATGGCAAGG - Intergenic
1156370640 18:36468768-36468790 TGGCAGCCACAGCAGGGCCTGGG - Intronic
1157299239 18:46467741-46467763 CTGCAGCCTCAGCATGGCCTGGG + Intergenic
1157451386 18:47791733-47791755 CTGCAACAGCTGGAGGGGCTTGG + Intergenic
1157698601 18:49745020-49745042 CTGGAGCCACATGGGTGGCTGGG + Intergenic
1158625510 18:59068056-59068078 ATGCAGCCACAGGGGGGCGTTGG - Intergenic
1159021439 18:63146280-63146302 CTGCAGCCGCAGCCAGGGCTTGG + Intronic
1159378668 18:67628456-67628478 CTTCAGCCTCAGGAGCAGCTGGG + Intergenic
1159413418 18:68111381-68111403 TTGCAGCCAGAGAAGGGGCAAGG - Intergenic
1159464431 18:68762893-68762915 AGGCATCCACTGGAGGGGCTTGG + Intronic
1159775558 18:72600017-72600039 CTGTAACCACAGGCGGTGCTTGG - Intronic
1159968571 18:74621391-74621413 CTGCAGCCACAGGACAGACCCGG - Intronic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160444771 18:78918848-78918870 CAGCTGCCAAAGGAGGGTCTTGG + Intergenic
1160452161 18:78973566-78973588 CCGCAGCCAGAGGACGGGCCTGG - Intergenic
1160576384 18:79856649-79856671 CTGCAGTCCCAGGCGGGGTTCGG - Intergenic
1160682223 19:417100-417122 CTCCAGGCAAAGGAGGGGGTGGG + Exonic
1160816672 19:1039200-1039222 CTGAAGCCACAGGTGAGTCTGGG + Intergenic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1160894630 19:1396723-1396745 CTCCCGCCCCAGGAGGGGCGTGG - Intergenic
1161041068 19:2111040-2111062 GAGCAGCCATAGGAGGCGCTTGG - Intronic
1161067938 19:2247723-2247745 CAGCAGGCACGGGTGGGGCTAGG - Intronic
1161290290 19:3490507-3490529 CTGCACCCACAACAGGAGCTGGG + Intergenic
1161488798 19:4550477-4550499 CTTCAGCCACCCGAGTGGCTGGG + Intronic
1161709329 19:5838963-5838985 TTGAAGCCACAGGTGGGGCAAGG - Exonic
1161804591 19:6435368-6435390 CTTCAGCCACCCGAGTGGCTAGG + Intergenic
1161977675 19:7615442-7615464 CTGCGGACACAAGCGGGGCTGGG - Exonic
1162034935 19:7933618-7933640 CTGCAGCCGCAGGAGGGCACAGG - Intronic
1162102040 19:8344737-8344759 CCTCAGCCTCAGGAGGTGCTAGG - Intronic
1162127447 19:8507042-8507064 CTGCAGGGAGAGGAGGGGCTTGG - Intergenic
1162441643 19:10695986-10696008 CTGCAGCTAGAGGCGGCGCTTGG - Intergenic
1162506917 19:11090879-11090901 CTGCAGACCAAGGAGGGGCGGGG - Intronic
1163007964 19:14408142-14408164 CTGTGGCCACAGGAGCTGCTGGG - Exonic
1163239436 19:16051161-16051183 CTTCCGCCTCAGGAGGAGCTGGG - Intergenic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163406877 19:17128406-17128428 CTGCAGCCCCATGAGGACCTGGG + Intronic
1163638629 19:18449518-18449540 CTCCAGCCACAGCAGGGGACGGG + Intronic
1163953660 19:20614060-20614082 CTGCAGCCAGCGGTGGGTCTGGG - Intronic
1164703214 19:30300955-30300977 CTGCTGCAATAGGAGGGGATGGG + Intronic
1164714948 19:30384457-30384479 GTGCATCCACAAGAGGGTCTTGG - Intronic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1165390687 19:35537032-35537054 TAGCAGCCAGAGGAGGGGCTGGG - Intronic
1165906826 19:39199362-39199384 CTGTAGCACCAGGAGGGTCTTGG - Intronic
1166013905 19:39965599-39965621 CTTCAGCCTCTGGAGTGGCTGGG - Intergenic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166133000 19:40757824-40757846 CCTCAGCCACAGGAGTAGCTGGG - Intronic
1167048373 19:47064967-47064989 CTGCAGCCACATGGTGGGCCAGG + Exonic
1167658621 19:50782726-50782748 CTGAACCCACAGTTGGGGCTTGG - Intergenic
925046731 2:778055-778077 CTGCAGCCACAGGACAGCCTTGG + Intergenic
925788589 2:7457843-7457865 CTTCAGCCACCCGAGGAGCTGGG + Intergenic
926020591 2:9491702-9491724 CTTCAGCCACAGGCAGGGATGGG - Intronic
926173239 2:10566955-10566977 CTTCAGCTACAGGAGAGGGTGGG - Intergenic
926836966 2:17033753-17033775 CTTCAGCCACCCGAGGAGCTGGG + Intergenic
927148763 2:20183959-20183981 CTGCACCCACAGGAGAGGTCTGG + Intergenic
927316702 2:21691412-21691434 CTTCAGACACAGGAGAAGCTAGG + Intergenic
927745919 2:25620909-25620931 CTTCAGCCTCCGGAGTGGCTGGG - Intronic
927917619 2:26947062-26947084 CTGCAGGGGCAGGAGAGGCTGGG + Exonic
928979373 2:37122313-37122335 CTGCAGCAAGAGGAGGAGCAAGG + Intronic
929553794 2:42911203-42911225 CTGTAGCGACAGGGGAGGCTGGG + Intergenic
930096430 2:47570258-47570280 CAGCAGCAGCAGGAGGGGCGCGG + Exonic
930198721 2:48532700-48532722 CAGCAGCCCGAGGAGAGGCTGGG + Intronic
931420740 2:62124663-62124685 CTTCAGCCACATGAGTAGCTGGG + Intronic
934562154 2:95318964-95318986 CTGCAGCCGCCGGCAGGGCTGGG + Intronic
934966177 2:98724957-98724979 CCTCAGCCACAGGAGTAGCTGGG - Intronic
935197416 2:100825837-100825859 CATCAGCCACCAGAGGGGCTGGG + Intronic
935978649 2:108605020-108605042 CTGCAGCTGCAGGTGAGGCTAGG - Intronic
936077766 2:109412564-109412586 CTGCAGCACCAGCAGGGGCTGGG - Intronic
936111861 2:109671287-109671309 CTGCAGCCAGGGCAGGGGCAGGG + Intergenic
936518704 2:113198659-113198681 AAGCAGCCACAGGAGGGGGCGGG + Intronic
937124362 2:119464009-119464031 GTGCAGCCTCAGCAGGGGCTTGG + Intronic
937906094 2:127053553-127053575 CAGCAGGCACAGGAGTGGCTCGG + Intronic
938081632 2:128373394-128373416 GAGCAGCCCCAGGAGGGCCTTGG - Intergenic
938444527 2:131366924-131366946 CTGGAGCCACAGGCCAGGCTGGG - Intergenic
938854875 2:135299176-135299198 CTGCATCCACTGTGGGGGCTTGG + Intronic
939569665 2:143825617-143825639 CTGTAGCCAACGGAGGGGGTTGG - Intergenic
939635849 2:144581920-144581942 CTGCAGCCCCAACAGAGGCTTGG + Intergenic
940020137 2:149147627-149147649 CTGCAGCCTCTGGAGTAGCTGGG + Intronic
941792237 2:169565376-169565398 CTTCAGCCTCAGGAGTAGCTGGG + Intronic
942453422 2:176122471-176122493 CCGCATCCAGAGGAGGCGCTGGG - Intergenic
944022796 2:195126062-195126084 CCGCAGCCTCAGCTGGGGCTTGG + Intergenic
944485381 2:200199881-200199903 CTGCAGCTGCTGTAGGGGCTGGG - Intergenic
945058651 2:205889528-205889550 CTGGAGGCACAGGAAGGGCAGGG + Intergenic
946132533 2:217617975-217617997 TTTCAGACACAGGAGGAGCTGGG + Intronic
946251817 2:218418631-218418653 CAGAAGCCAAGGGAGGGGCTGGG + Intergenic
946767320 2:223052803-223052825 CTGCCTCCACAGCAGGGGCTGGG - Exonic
946834639 2:223760929-223760951 CTGTAGCCTCGGGAGGGGCCTGG + Intronic
948063753 2:235061528-235061550 CTGCAGCCTCCGGAGTAGCTGGG - Intergenic
948120069 2:235523341-235523363 CTGGAGCCCCAGGAGGCTCTTGG + Intronic
948609611 2:239158568-239158590 CAGCAGGTGCAGGAGGGGCTGGG + Intronic
948732676 2:239977048-239977070 ATCCAGCCACAGGAAGAGCTGGG + Intronic
948789591 2:240370407-240370429 CTGGGGCCTCAGGAGGAGCTGGG - Intergenic
948802250 2:240438251-240438273 CTGCAGCCATAGGGGGTGCAGGG - Intronic
948812986 2:240494487-240494509 ATGCTCCCACAGTAGGGGCTAGG - Intronic
1169389709 20:5179677-5179699 CTGCAACCTCAGGGGGAGCTAGG + Intronic
1170317276 20:15056132-15056154 CTGCATACAGAGGAGGGGGTCGG - Intronic
1170962445 20:21037392-21037414 CTGCAGGGCCAGGAGGGGCAGGG + Intergenic
1171018116 20:21560243-21560265 CTGCAGCCCCTGGTGGGGCTGGG + Intergenic
1171367647 20:24637067-24637089 CTGCAGCCACGGGCAGGGCCCGG + Intronic
1171460101 20:25293227-25293249 GTGCAGCCAACGGAGGGGCGCGG - Intronic
1172331519 20:34079033-34079055 CTGCAGCCACAGGAGGCTCTTGG - Intronic
1172457987 20:35092707-35092729 CGGCAGCCACAGTGGCGGCTTGG - Exonic
1172655266 20:36532997-36533019 CTGCTGCTCCAGGCGGGGCTGGG + Intergenic
1172712029 20:36932531-36932553 CTGCAACCTCAGGAGTAGCTGGG + Intronic
1172887459 20:38240831-38240853 CTGCAGCTGCAGGAGAAGCTGGG + Exonic
1172969752 20:38864866-38864888 CTCCAGCTCCAGGAGGGGCCAGG - Intronic
1173176850 20:40771250-40771272 CTGCAGGGACAGGAGGCACTTGG - Intergenic
1173865071 20:46308113-46308135 CTCCAGCCGCAGGAGGAGCCGGG - Intronic
1174064328 20:47853654-47853676 TCTCAGACACAGGAGGGGCTGGG + Intergenic
1174398890 20:50265114-50265136 CTGCAGCCACACAGGCGGCTTGG + Intergenic
1174411314 20:50338540-50338562 CTGGAGCTACAGGTGGGGTTGGG - Intergenic
1175102124 20:56586815-56586837 CTCCAGCCTCTGGAGTGGCTGGG + Intergenic
1175662779 20:60830793-60830815 CTGCAGCCACCCGAGTAGCTGGG + Intergenic
1175715670 20:61252972-61252994 CTTCAGCCACGGCCGGGGCTGGG - Intronic
1175803952 20:61816992-61817014 CTGCACCTACAGGAAAGGCTTGG + Intronic
1175920054 20:62446464-62446486 CAGCAGCCCCAGGAGGGACCAGG + Intergenic
1176021893 20:62966410-62966432 GTGGAGCCACGGGAGGGGCTGGG - Intronic
1176200814 20:63859517-63859539 CTGCAGCCAAGGGATGGGCAAGG - Intergenic
1177250254 21:18582968-18582990 CAGCAGCCACAGCAGTGGATAGG - Intergenic
1178933627 21:36841782-36841804 CTGCAGCCACAGGGTAGGCCTGG + Intronic
1179443052 21:41409109-41409131 CTCCAGCCACCTGAGTGGCTGGG - Intronic
1179463199 21:41551758-41551780 CTGCTGCCCCAGGAGTGGGTGGG + Intergenic
1179479929 21:41670532-41670554 CTGCAGCAACAGGAGGTGGAGGG + Intergenic
1179951771 21:44712270-44712292 GTCCATCCCCAGGAGGGGCTGGG + Intergenic
1179967477 21:44815739-44815761 CTGCAGCCCCGGGAGAGGCTGGG + Intronic
1180138756 21:45878131-45878153 CTGCTGCCACAGGATCGCCTGGG - Intronic
1180338064 22:11597720-11597742 CTGCAGCCCCACGAGGAGCCCGG + Intergenic
1180840435 22:18956590-18956612 CTGAGACCCCAGGAGGGGCTGGG + Intergenic
1181061055 22:20282186-20282208 CTGAGACCCCAGGAGGGGCTGGG - Intronic
1181426698 22:22848577-22848599 CTGCAGCCAGAAGAGAGGCTGGG + Intronic
1181495251 22:23283954-23283976 CTGCAGGCACAGGGAAGGCTGGG - Intronic
1181533417 22:23529964-23529986 CTGCATCCTCAGCAGGGGGTAGG - Intergenic
1181629897 22:24145255-24145277 CTGAATGCACTGGAGGGGCTGGG + Intronic
1182420538 22:30246531-30246553 GCGCAGCCACCGGAGGCGCTGGG - Intronic
1182435913 22:30329735-30329757 CTGCAGCCACAGGCTGTGATGGG - Intergenic
1182525522 22:30915332-30915354 CTGCAGCCTCTTGAGGAGCTGGG - Intergenic
1183051930 22:35269860-35269882 CTTCAGCCTCAGGAGTAGCTGGG - Intronic
1183172820 22:36200484-36200506 CGGCAGCCACAGCAGGGGCTAGG - Intronic
1183177375 22:36234008-36234030 CGGCAGCCACAGCAGGGGCTGGG - Intronic
1183180456 22:36256508-36256530 TGGCAGCCACAGCAGGGGCTGGG + Intronic
1183461563 22:37953983-37954005 CTGGAGGCACAGGAGGGCCCAGG + Intronic
1183499180 22:38168226-38168248 CTGGAGACACTGGAGGTGCTTGG + Intronic
1183590501 22:38776828-38776850 CTGCAGTGACAGGAGTGACTAGG + Intronic
1184037644 22:41926277-41926299 CTGCAGCCGCAGGAGTCGGTGGG - Exonic
1184150527 22:42635773-42635795 CAGCAGGCACAGGAGGGGTGTGG - Intronic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184411652 22:44329606-44329628 TTTCAGCCACAAGAGGGGCCGGG + Intergenic
1184417424 22:44360442-44360464 CTGCAGCCCCGGGTGGGGCAGGG - Intergenic
1184877217 22:47283375-47283397 TTACAGCAGCAGGAGGGGCTCGG - Intergenic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
949841508 3:8325168-8325190 CTGCATCCGCAAGAGAGGCTAGG + Intergenic
950113964 3:10438608-10438630 CTGAAACCACAGCAGGGGCCTGG + Intronic
950428061 3:12935252-12935274 CAGCAGTCCCAGGAGGGGCTAGG + Intronic
950456066 3:13093441-13093463 CTTCCTCCACAGGAGGAGCTGGG + Intergenic
950502269 3:13372063-13372085 CTGCCTCCACAGGAGAGGCAGGG + Intronic
952407054 3:33014208-33014230 GTGCAGCCACCTGGGGGGCTGGG - Exonic
953041683 3:39261161-39261183 CTTCATCCACAGGAGGGCCAAGG - Intergenic
953262856 3:41357053-41357075 CTGCAACCACTGGAGGGTGTTGG + Intronic
954199205 3:49014249-49014271 CTGCAGCCACAAGGGGGCCAAGG - Exonic
954627998 3:52033202-52033224 CTGCAGCCTCAGGATGTGCCTGG - Intergenic
954874552 3:53793146-53793168 GAGCAGTCTCAGGAGGGGCTGGG - Intronic
955390126 3:58516374-58516396 AATCAGCCAGAGGAGGGGCTGGG - Intronic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
955784458 3:62522250-62522272 CTGCAGCCTCCTGAGAGGCTGGG + Intronic
956012699 3:64848600-64848622 CTTCAGCCACCTGAGGTGCTAGG - Intergenic
956134071 3:66081840-66081862 CTGCATCCTCATGTGGGGCTTGG - Intergenic
956959631 3:74383599-74383621 CTGCAGCCACCTGAGTAGCTGGG + Intronic
959727535 3:109560990-109561012 CTGCAGCCACTGTGGGGGATGGG + Intergenic
960096750 3:113696664-113696686 CTGCGGCCGCGGGAGGGGCGGGG - Intergenic
960611927 3:119562595-119562617 CAGCATCCACAGGGAGGGCTGGG + Intergenic
960645325 3:119874244-119874266 CAGCATCCACATGAGGGTCTTGG - Intronic
961349078 3:126287607-126287629 CCGCAGCCCCAGGAAGGGCGGGG - Intergenic
961392034 3:126557959-126557981 CTGCAGCCACAGCCTGGGCCAGG + Intronic
961413419 3:126740228-126740250 CTGCAGCTGCAGGAGGGACAAGG - Intronic
961780746 3:129318878-129318900 CTGCAGCCACAGGCTGGGCCAGG + Intergenic
961817496 3:129558813-129558835 CTGGAGGCTCAGGAGGGGGTTGG - Intronic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
962080684 3:132136259-132136281 CAGCAGCCTCAGGAGGGACTGGG + Intronic
962355949 3:134694325-134694347 CTGCAGCCAGATGAGGAGCCTGG - Intronic
962675074 3:137750211-137750233 CAACAGCCACAGGAGTGGCTTGG + Intergenic
963093326 3:141507860-141507882 CTGTAGCCACAAGAGAGGCTGGG + Intronic
963103019 3:141623621-141623643 CAGCAGCCACAGGCGGGCCAAGG - Intergenic
963163779 3:142180199-142180221 CTGCAGCCACAGGATTGCCAGGG - Intronic
965622584 3:170655919-170655941 GTGCAGCCTCAGGAGGGCCCTGG + Intronic
966309129 3:178574331-178574353 CTGAAGCCCCAGGAGGAGCCAGG - Intronic
966411800 3:179652976-179652998 CTGCAGCGTCAGGCGGGGCTGGG - Exonic
968162118 3:196435113-196435135 CTTCAGCCACACGAGTAGCTGGG - Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968612574 4:1563882-1563904 CTGCCTCCACCGTAGGGGCTGGG - Intergenic
969392554 4:6901236-6901258 CTCCAGCCACAGAGGGGCCTTGG + Intergenic
970170473 4:13284307-13284329 CTGTAGCCACCTCAGGGGCTTGG - Intergenic
970407692 4:15778948-15778970 CTGCAGCCCGGCGAGGGGCTGGG - Intronic
972270118 4:37502725-37502747 CTGCAGCTGCAGGAGGGAGTAGG + Intronic
973177125 4:47220826-47220848 GAGAAGCCACAAGAGGGGCTGGG - Intronic
974375934 4:61075625-61075647 CTTCAGCCACCTGAGTGGCTGGG - Intergenic
979351669 4:119650703-119650725 CTGAAGCCAGAGCAGAGGCTTGG + Intergenic
979434605 4:120673703-120673725 CTGCAGCCACTGTGGGGGATGGG - Intergenic
981920392 4:150079109-150079131 CTGCTGCCCCCGGAGGAGCTGGG - Exonic
984293265 4:177822239-177822261 CTCCAGCCTCAGATGGGGCTTGG + Intronic
984652601 4:182286539-182286561 CTGCATCTACAGAAAGGGCTGGG - Intronic
984765646 4:183398555-183398577 CTGCCGCCCCGGGAGGAGCTAGG - Intergenic
984771531 4:183440849-183440871 CTGCAGACATAGGTGTGGCTGGG - Intergenic
985505672 5:278860-278882 CTGGGGACACGGGAGGGGCTGGG + Intronic
985570977 5:644708-644730 CTGCAGCTGCTGGAGGGGCCTGG + Intronic
985677758 5:1241050-1241072 GTGCAGGCTCAGGAGGGGCGCGG + Intronic
985726298 5:1517523-1517545 CTGCAGGCACAGGAGGCACCGGG + Intronic
986552940 5:8978916-8978938 ATGCAGCCATATAAGGGGCTGGG - Intergenic
989445951 5:41528387-41528409 CTGCAGCTCCAGGATGGCCTTGG - Intergenic
990245404 5:53859218-53859240 CTTCAGCCACAGGAGGGTGCAGG - Intergenic
990404241 5:55472004-55472026 CTTCAGCCACCTGAGGAGCTGGG - Intronic
991039453 5:62160765-62160787 CTTCAGCCACTGAAGTGGCTGGG + Intergenic
991068254 5:62447699-62447721 CTGCAGCCTCTGGAGTAGCTGGG + Intronic
992464404 5:76989446-76989468 CTTCTGCCACAAGACGGGCTTGG + Intergenic
992775497 5:80085288-80085310 CTTCAGCCACCTGAGGAGCTGGG - Intergenic
993852008 5:93022221-93022243 CTGGAGACAGATGAGGGGCTGGG + Intergenic
995145908 5:108787020-108787042 CTGCAGAGCCAGCAGGGGCTGGG + Intronic
996330022 5:122318109-122318131 CTGCACCCACAGGAGGAGGCAGG - Intronic
997120171 5:131165224-131165246 CGGCGGCCAGAGGAGAGGCTCGG + Exonic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
997704034 5:135930349-135930371 CTGGAGGCACAGGAGCGCCTAGG - Intronic
998007816 5:138668709-138668731 CTGAAGGCACGGGAGGGGCCGGG - Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
1000253257 5:159514818-159514840 CTGCAGCAACAGGGTGGGGTGGG - Intergenic
1001036406 5:168299895-168299917 CTCCAGCCACATGTGGTGCTAGG + Intronic
1001873612 5:175180129-175180151 CTGAAGCCACAGGAGACTCTTGG - Intergenic
1002078818 5:176725892-176725914 CTGCAGCCAGAGGAAGGACCTGG + Intergenic
1002179661 5:177424545-177424567 CTGAAGTCTCAGGAGGGGCCTGG - Intronic
1002399814 5:178985363-178985385 CTGCTGTCACAGGAGGGGAGGGG + Intronic
1002439248 5:179255839-179255861 CTGCAGCAGCAGGCAGGGCTGGG + Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002756611 6:166614-166636 CTGCAGCCTCCGGAGTAGCTGGG - Intergenic
1003264924 6:4557204-4557226 CTGCAGACCCAGGAGGAGTTGGG - Intergenic
1004869985 6:19894903-19894925 CTGCAGCTTCAGGATGGGGTAGG - Intergenic
1005035282 6:21550580-21550602 CTGCAGCCTCCTGAGTGGCTGGG - Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1005315576 6:24599813-24599835 GGGCAGTCACAGGAGGGGGTAGG - Intronic
1005327991 6:24720764-24720786 CTGCAGCCACCGGCGGGGGGGGG - Exonic
1006135443 6:31892973-31892995 CTGGAGCCCCAGGCGGGGGTGGG + Intronic
1006365006 6:33610151-33610173 CTGGAGCCACAGGAAGGGATTGG - Intergenic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006911358 6:37565767-37565789 CAGCAGCCTCAGGGAGGGCTGGG - Intergenic
1007117190 6:39351059-39351081 CAGCAGTCACCGAAGGGGCTTGG + Intronic
1007398746 6:41591717-41591739 CTGAAGCCTGAGGTGGGGCTAGG + Intronic
1007766714 6:44165002-44165024 CCTCAGCCACAGGAGTAGCTGGG + Intronic
1007789413 6:44300645-44300667 GTGCAGCCACATGGGGGGCAAGG - Exonic
1011588947 6:88952239-88952261 CTGTAGCCACTGTAGGGGATGGG - Intronic
1013248911 6:108314952-108314974 CTGCAGCCACATGAGTAGATGGG + Intronic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1013471310 6:110468862-110468884 CGGCAGCCAGTGCAGGGGCTGGG - Intronic
1014750074 6:125245583-125245605 CTGCAGCCACTGTGGGGGTTGGG + Intronic
1014943796 6:127474392-127474414 CTTCAGCCTCCGGAGTGGCTGGG + Intronic
1015804204 6:137092150-137092172 CTGCAGCAACAACAGGGGCAAGG - Intergenic
1016323144 6:142870115-142870137 CTGCAGACCCAGGTGGGTCTTGG - Intronic
1016977417 6:149822962-149822984 CTGCAGTCACAATAGGGGTTAGG + Intronic
1018360800 6:163065553-163065575 CTGCAGCCACAGGGGGCCATGGG + Intronic
1018905177 6:168071830-168071852 CTTGAGCAACAGGAGGGGCTGGG - Intronic
1018962016 6:168456008-168456030 CTGCAGTCAGAGGCTGGGCTGGG - Intronic
1019067657 6:169315923-169315945 GTGCAGACACAGGAGGGTGTTGG - Intergenic
1019100646 6:169626464-169626486 CTGCACCAGCAGGAGGGGCCTGG - Intronic
1019135440 6:169904868-169904890 CTGGAGCTGCAGGAGGGGCAGGG + Intergenic
1019144946 6:169970548-169970570 CTGCAGGCACAGGAGGCCCCGGG - Intergenic
1019190790 6:170249445-170249467 CGGGAGCCACAGGCTGGGCTGGG + Intergenic
1019593631 7:1848179-1848201 CTGCAGCCCCAGGAAGGGTCAGG + Exonic
1019657216 7:2202279-2202301 ACTCAGCCACAGGAGGAGCTGGG + Intronic
1019674896 7:2305037-2305059 CTGCAGACGCCGGAGGGTCTGGG + Intronic
1019719678 7:2560449-2560471 CTGCACCCGCAGTAGGGGCTTGG + Intronic
1019803436 7:3105254-3105276 CTGGGGCCAGAGAAGGGGCTTGG - Intergenic
1019829302 7:3310706-3310728 TTGCAACCAGAGGAGGGTCTGGG + Intronic
1020089857 7:5332959-5332981 CTGCGGCCCAAGAAGGGGCTGGG - Exonic
1021940124 7:25670746-25670768 CTGCTGTCACAGGCGAGGCTGGG - Intergenic
1022041799 7:26588319-26588341 CTGCACACACAGGCGGGGATGGG + Intergenic
1022472149 7:30688618-30688640 CTGCATCCACAGGATGGGAGTGG - Intronic
1022505632 7:30907368-30907390 CTGCACCCACAGGAGGCCATGGG - Intergenic
1022522634 7:31017813-31017835 CTGCTGCCACAGGAGGTTCTGGG + Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023220968 7:37920042-37920064 CTTCAGCCTCAGGAGTAGCTGGG + Intronic
1023352682 7:39335939-39335961 TTGGAGCCACAGGAGAGCCTTGG - Intronic
1024394310 7:48848239-48848261 CAGGAGCCAGAGGAGGGGCCTGG + Intergenic
1024400956 7:48924406-48924428 CAGGAGCCAGAGGAGGGGCCTGG - Intergenic
1024983091 7:55173811-55173833 CAGCAGCCACGGCATGGGCTTGG - Intronic
1025247333 7:57327201-57327223 CTAAAGACCCAGGAGGGGCTGGG + Intergenic
1026010028 7:66629194-66629216 CTGCTGCCACAGGAGGTACCCGG + Exonic
1026483267 7:70796893-70796915 CTTCAGCCACACGAGTAGCTGGG + Intergenic
1026548077 7:71341920-71341942 CTGCATCCACAGGAGCCTCTAGG - Intronic
1026734625 7:72941938-72941960 TTGGAGTCAAAGGAGGGGCTGGG - Exonic
1026784960 7:73296850-73296872 TTGGAGTCAAAGGAGGGGCTGGG - Intergenic
1026823533 7:73566289-73566311 CTGCAGCCTCCAGAGAGGCTGGG + Intergenic
1027109117 7:75423080-75423102 TTGGAGTCAAAGGAGGGGCTGGG + Exonic
1027124764 7:75548590-75548612 CTGCAGCCTCTGGAGTAGCTGGG + Intronic
1028522144 7:91743091-91743113 CTTCAGCCACAGGATGGGAAAGG + Intronic
1029550834 7:101236329-101236351 CCGCTGCCTCAGGAGGGGCTGGG + Intronic
1029995067 7:104999841-104999863 CTTCAGCCTCTGGAGTGGCTGGG + Intergenic
1032133218 7:129249111-129249133 CTGCAGCCCCCGGAGTAGCTGGG + Intronic
1032328993 7:130959856-130959878 CTGCAGCCACGTGAGTAGCTGGG - Intergenic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1032952039 7:136925671-136925693 CTGCAGAGACAGGAGGTGCCAGG - Intronic
1033186534 7:139231723-139231745 CTGCAGCGACATGGGCGGCTCGG - Exonic
1033597149 7:142866267-142866289 CTGCAGCCTGAGGAGGGTCAGGG - Exonic
1033673997 7:143519772-143519794 CTGGAGACCTAGGAGGGGCTTGG + Intergenic
1034280001 7:149846740-149846762 CTTCTCCCACAGTAGGGGCTGGG - Intronic
1034491224 7:151394139-151394161 ATGCAGCGAGATGAGGGGCTTGG - Intronic
1034956850 7:155340183-155340205 CTGCAGCCACAGGCCAGGGTTGG - Intergenic
1035168816 7:157006687-157006709 AAGCAGCAACGGGAGGGGCTGGG - Intronic
1036293599 8:7517436-7517458 CTTCAGCCTCTGGAGGAGCTGGG + Intergenic
1036328962 8:7803559-7803581 CTTCAGCCTCTGGAGGAGCTGGG - Intergenic
1036575097 8:10020369-10020391 CTGCAGCAAGCGAAGGGGCTAGG + Intergenic
1036776729 8:11617894-11617916 CAGCAGCCACAGGCAGGGCGGGG + Intergenic
1037072950 8:14675052-14675074 CTTCAGCCTCAGGAGTTGCTGGG + Intronic
1037886894 8:22600058-22600080 CCGCAGCCACGGAGGGGGCTGGG - Intronic
1038442958 8:27584481-27584503 GTGAATCCAGAGGAGGGGCTGGG + Intergenic
1039750722 8:40475918-40475940 CTCCTGCCACAGGAGGGGATCGG + Intergenic
1040388162 8:46927938-46927960 CTGTAGCCACATGAGGGAGTGGG - Intergenic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1041326984 8:56678332-56678354 CTTCAGCCTCTGGAGTGGCTGGG - Intergenic
1041763710 8:61394503-61394525 CTGCAGCCACTGTGGGGGATTGG + Intronic
1042367260 8:67952062-67952084 CGGCAGCCACAGCAGTGACTTGG - Intergenic
1042435009 8:68753929-68753951 CAGCAGCCACTGAAAGGGCTTGG - Intronic
1042572050 8:70176528-70176550 CTCCAGCCACAGGATTGGCTTGG + Intronic
1042614395 8:70632702-70632724 CTCCAGCCACAGGGGTAGCTGGG + Intronic
1043110429 8:76172921-76172943 GTGTAGCCACAGGAGAGGCAGGG - Intergenic
1044198984 8:89412572-89412594 GGGCAGCCACAGGATGGGGTAGG + Intergenic
1045018004 8:98015498-98015520 CTGCAGCAACGGGAGCTGCTTGG - Intronic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1048963751 8:139600329-139600351 CAGCAGCCACAGGATGGGTTGGG + Intergenic
1049421987 8:142521075-142521097 CTGCAGCCACAGCAGAGGGCAGG - Intronic
1049662265 8:143824747-143824769 CTGCTGCCTCAGGAGGGCATGGG - Intronic
1049674810 8:143884718-143884740 CTGCAGGAACAGGAGGTGCAGGG - Intergenic
1049794341 8:144489584-144489606 CTGCAGCCACATGAAGCTCTGGG - Intronic
1053437179 9:38083734-38083756 CTGCAGCCTCCCGAGTGGCTGGG + Intergenic
1056556744 9:87695645-87695667 CTGCCTACACAGGAGGTGCTTGG - Intronic
1056591334 9:87968212-87968234 ATGGAGCCACAGGAGGGCCCTGG + Intronic
1056659776 9:88535258-88535280 CTCCAGCCACAGGCGAGGCCTGG + Exonic
1056850748 9:90081704-90081726 CTTCAGGCCCAGGAGGAGCTGGG - Intergenic
1057721075 9:97532322-97532344 CCCCAGCCAGAGGAGGGGTTGGG - Intronic
1057741076 9:97711564-97711586 CTGCCGCCAGAGGAGGGGGCAGG + Intergenic
1058383266 9:104403331-104403353 ATACAGCCACATTAGGGGCTAGG + Intergenic
1059921662 9:119167233-119167255 CCGGGGCCACAGGAGGGGCCAGG + Exonic
1060585560 9:124783155-124783177 CTGCAGCCTGCGGAGGGGCAGGG - Intronic
1060743738 9:126116496-126116518 CTGCCCCCACCTGAGGGGCTTGG + Intergenic
1060798734 9:126530444-126530466 CTGCTGCCAGAGAAGGGGCCTGG + Intergenic
1060799054 9:126532237-126532259 CAGAAGCCACAGGAGGGCCAGGG - Intergenic
1061446067 9:130638838-130638860 CCACAGCCACAGGTGAGGCTGGG - Intergenic
1061509324 9:131050814-131050836 GGGCAGTCCCAGGAGGGGCTGGG + Intronic
1061912868 9:133734137-133734159 CAGCAGCCACACGTAGGGCTCGG + Exonic
1061929766 9:133826482-133826504 ATGCAGCCACCGGAGTGGCGGGG + Intronic
1062004203 9:134231139-134231161 CTGCAGACACAGGCGGACCTGGG + Intergenic
1062081310 9:134625185-134625207 CTGCAGAGTCAGGAGGGCCTGGG - Intergenic
1062262579 9:135670325-135670347 CACCATCCACAGGAGGTGCTAGG + Intergenic
1062320204 9:135986933-135986955 CTCCAGCCAGGGGAGGGGCAGGG - Intergenic
1062495723 9:136830675-136830697 CTGCTGCCACAGGAACGGCCTGG + Intronic
1062647774 9:137558018-137558040 CTGCAGCCTCCGGAGTAGCTGGG - Intronic
1203760831 EBV:12494-12516 CTGCTGTCTCAGGAGGGGCCTGG + Intergenic
1203761760 EBV:15566-15588 CTGCTGTCTCAGGAGGGGCCTGG + Intergenic
1203762689 EBV:18638-18660 CTGCTGTCTCAGGAGGGGCCTGG + Intergenic
1203763618 EBV:21710-21732 CTGCTGTCTCAGGAGGGGCCTGG + Intergenic
1203764547 EBV:24782-24804 CTGCTGTCTCAGGAGGGGCCTGG + Intergenic
1203765476 EBV:27854-27876 CTGCTGTCTCAGGAGGGGCCTGG + Intergenic
1203766405 EBV:30926-30948 CTGCTGTCTCAGGAGGGGCCTGG + Intergenic
1203767334 EBV:33998-34020 CTGCTGTCTCAGGAGGGGCCTGG + Intergenic
1185504707 X:623893-623915 CTGGAGACGCAGGCGGGGCTGGG - Intergenic
1188261513 X:28030419-28030441 CTCCAGACAGAGGATGGGCTGGG + Intergenic
1189001983 X:36957623-36957645 CCGCAGCCTGGGGAGGGGCTGGG + Intergenic
1192451896 X:71249951-71249973 CTGCAGCCCCAGGATGGGAGGGG + Intronic
1192594170 X:72388688-72388710 ATGCAGCCACATTAGGGGTTAGG - Intronic
1194086882 X:89538918-89538940 CTGCAGCCAAAGAAGGGAGTAGG + Intergenic
1195095057 X:101493889-101493911 CTGCATCCAGATCAGGGGCTGGG + Exonic
1196619468 X:117806279-117806301 ATGCAGCCACAGATGGGGGTTGG - Intergenic
1196971184 X:121110132-121110154 CTGCAGCCACTGTGGGGGATGGG - Intergenic
1197494703 X:127163652-127163674 CTTCAGCCACCTGAGTGGCTGGG + Intergenic
1198256161 X:134925867-134925889 CTGCTGCCTCCGGAGGGGCAGGG + Intergenic
1198721881 X:139631114-139631136 ATATAGCCACAGGAGGGGATGGG + Intronic
1199944730 X:152656218-152656240 CTGCAGGCTGGGGAGGGGCTGGG - Exonic
1200002340 X:153068555-153068577 CTGCTGCCACAGAAGGTTCTTGG + Intergenic
1200005384 X:153081455-153081477 CTGCTGCCACAGAAGGTTCTTGG - Intergenic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1200159732 X:154000212-154000234 CTGCAGCCTGATGAGGTGCTAGG - Intergenic
1200912914 Y:8546829-8546851 ACGCAGCCACAGGAGCTGCTGGG + Intergenic
1200915169 Y:8565034-8565056 ATGCAGCCTCAGGAGCTGCTGGG + Intergenic
1200964713 Y:9025599-9025621 ATGCAGCCTCAGGAGCTGCTGGG - Intergenic
1201525392 Y:14927322-14927344 CTTCAGCCTCTGGAGGAGCTGGG + Intergenic