ID: 999432521

View in Genome Browser
Species Human (GRCh38)
Location 5:151536511-151536533
Sequence ATTCCTGCCCTGCTGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999432521_999432525 -9 Left 999432521 5:151536511-151536533 CCCTGCAGCAGCAGGGCAGGAAT 0: 1
1: 0
2: 1
3: 27
4: 313
Right 999432525 5:151536525-151536547 GGCAGGAATCCCTCCTAGGTGGG No data
999432521_999432529 6 Left 999432521 5:151536511-151536533 CCCTGCAGCAGCAGGGCAGGAAT 0: 1
1: 0
2: 1
3: 27
4: 313
Right 999432529 5:151536540-151536562 TAGGTGGGCTGCTCTTCCAAAGG 0: 1
1: 0
2: 1
3: 11
4: 101
999432521_999432524 -10 Left 999432521 5:151536511-151536533 CCCTGCAGCAGCAGGGCAGGAAT 0: 1
1: 0
2: 1
3: 27
4: 313
Right 999432524 5:151536524-151536546 GGGCAGGAATCCCTCCTAGGTGG 0: 1
1: 0
2: 0
3: 22
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999432521 Original CRISPR ATTCCTGCCCTGCTGCTGCA GGG (reversed) Intronic
900652138 1:3734910-3734932 CTTCCTGCCCTTCAGCTGGAAGG - Exonic
901883154 1:12205579-12205601 CACCCTGCCCTGCTGCTGCATGG - Intronic
903221606 1:21872664-21872686 CTGCCTGCCCTGCTTCTGTATGG - Exonic
903287575 1:22286434-22286456 ATCCCAGCCCTGCTGCTCCCGGG - Intergenic
903355798 1:22746687-22746709 AATCCTGACCTCCTTCTGCACGG + Intronic
904440494 1:30526542-30526564 ACCCCTGCCCTGCAGATGCATGG - Intergenic
904840840 1:33370906-33370928 ATTCCAGCCATGATGCTACATGG + Intronic
905091222 1:35432945-35432967 ACTGCTGCCCTCCTGCAGCAGGG + Intergenic
905933681 1:41807185-41807207 ATGCCGGCCCTGCAGCAGCATGG - Intronic
906240354 1:44238811-44238833 CTTCCTCCCCTCCTCCTGCAGGG - Intronic
906718655 1:47989333-47989355 ATTCCTTCAATGATGCTGCATGG + Intronic
907539207 1:55196879-55196901 ATGCCAGCCCTGCTGCTACCCGG + Intronic
908424619 1:63994526-63994548 TTTTCTGACCTGCTGCTTCAAGG - Intronic
910387343 1:86699409-86699431 ATGTCTGCCATGCTGCTGTAAGG - Intergenic
910507959 1:87971729-87971751 ATGCCTGTGCTGCTGCTCCATGG - Intergenic
911263452 1:95715243-95715265 ATTCTTACCCTGCTCCTGCCTGG + Intergenic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
914764772 1:150628452-150628474 ATACCTACCCTGGTGGTGCAGGG + Intronic
914948306 1:152086463-152086485 CTTTCTGCCCTGCTGTTCCATGG + Exonic
915593694 1:156884534-156884556 CTTCCTGCCCTGCTCCCACAGGG + Intergenic
916561300 1:165935959-165935981 ATCCCTGCCATGCTGGTTCATGG - Intergenic
919151162 1:193700749-193700771 ATTCCTGCCTTGCTCTTACAGGG + Intergenic
919613642 1:199777901-199777923 CTTCCTGCCCTCCTGCTGTGTGG + Intergenic
919805067 1:201376655-201376677 ATTCCTGGCCTGCTGTAGCCGGG - Intronic
919843499 1:201626381-201626403 ATGCCTGACCTGCTTCTCCAGGG + Intronic
920925613 1:210338689-210338711 ATTCCAGCTTTGCTGCTTCATGG - Intronic
921939869 1:220828292-220828314 AGGCCTGCCTTTCTGCTGCAGGG + Intergenic
922000294 1:221470607-221470629 ATTCCTGCCCTGCTCATACAAGG + Intergenic
922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG + Intergenic
923248226 1:232154501-232154523 CTTTCTGCCATGCTTCTGCAAGG - Intergenic
1063568033 10:7189560-7189582 ATTCCTGGGCTGCTGCTGTTTGG + Intronic
1064338945 10:14469466-14469488 ATTTCTTCCCTGTTGCTGCCTGG - Intergenic
1066463046 10:35629082-35629104 ATTCCTTCCCCACTGATGCAAGG + Intergenic
1067061754 10:43081376-43081398 GCTCCTGCCCTGCTGCTCTAGGG + Intronic
1067469918 10:46528621-46528643 GAGCCTGCCCTGCAGCTGCAGGG + Intergenic
1069553717 10:69382815-69382837 ATGCCTGTCCTGCTCCTGCCAGG + Intronic
1069798714 10:71069337-71069359 GTGCCTGCCCTGCTGCTGGCTGG + Intergenic
1069816278 10:71196558-71196580 TTTCCTGTCCAGCTGCTGCTGGG - Intergenic
1072683262 10:97521730-97521752 ACTGCTGCCCAGCTGCTGCTGGG - Intronic
1072747229 10:97949327-97949349 ATTGCTCCCCTCCTGGTGCAGGG - Intronic
1072776050 10:98195149-98195171 ATTCCTGTCATGCTGCCTCATGG + Intronic
1073583460 10:104687605-104687627 TCTTCTGCCCTGCTCCTGCATGG - Intronic
1073883845 10:108015074-108015096 ATTTCTGCCCTGCTGTTTGAAGG - Intergenic
1074199460 10:111221988-111222010 ATTCCTCACCTGCTACTTCAAGG + Intergenic
1076435380 10:130437691-130437713 CTGCCTGCCCTGCTACTCCAGGG + Intergenic
1077528586 11:3083922-3083944 CCTCCTGCCCTACTGCAGCAGGG - Intergenic
1077679073 11:4222742-4222764 ATGCCTGAACTGCTGCTGCCAGG - Intergenic
1077688509 11:4319383-4319405 ATGCCTGAACTGCTGCTGCCGGG - Intergenic
1079156294 11:17951016-17951038 ATTCATACTCTGATGCTGCAGGG + Intronic
1079612975 11:22456149-22456171 CTTCCTGCTCTGCTCCTCCAAGG + Intergenic
1081543246 11:44051356-44051378 GTTCCTGACCTACTACTGCAGGG + Exonic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1083338972 11:61946287-61946309 CTTCCTGCCCAGCTGAGGCAGGG + Intergenic
1083400387 11:62419239-62419261 ATTCCTGCTCTGGAGCTGCTGGG + Intronic
1083699488 11:64466255-64466277 ATTTCTGCCTTTCTGCTGCCTGG + Intergenic
1083855374 11:65390582-65390604 CTTCCTGCTCAGCTGCTGCTGGG + Intronic
1085840157 11:80002304-80002326 ATCCCTGCTCTCCTGCTTCACGG - Intergenic
1088123979 11:106401325-106401347 ATACATGCACTGCTGCTGAATGG - Intergenic
1088861405 11:113803216-113803238 AATGCTGCCCTGCTGATGAAGGG - Exonic
1089018692 11:115188609-115188631 ATTTCTACCCTGATGCAGCAGGG + Intronic
1089514590 11:119024536-119024558 ATTAGTGCCCTGCAGCTGCAGGG + Exonic
1090292398 11:125556579-125556601 TTTCCTGCCCTGCTCATGCCTGG + Intergenic
1090568448 11:128021413-128021435 CTTCCTCGCCTGCTGCTGCAGGG - Intergenic
1090972080 11:131652784-131652806 ATTCCTGCCCTGCTGCAGCGTGG - Intronic
1091305877 11:134535786-134535808 ATTCCAGCCCTGCTCCGGAAGGG - Intergenic
1091461690 12:647897-647919 AGTCCTGCCCTGCCGCTTCCAGG + Intronic
1094624138 12:32106850-32106872 ATTCCGCACCGGCTGCTGCAGGG + Intronic
1097350843 12:58547043-58547065 ATCCCAGCCCTCCAGCTGCATGG - Intronic
1098463757 12:70763665-70763687 ATTGCTGTGCTTCTGCTGCATGG - Intronic
1100451719 12:94712933-94712955 CTTTCTGCCCTGCTGCTCCTGGG - Intergenic
1101316375 12:103632684-103632706 GTTCCTTTGCTGCTGCTGCAGGG - Intronic
1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG + Intergenic
1102152817 12:110700297-110700319 AGTCCTACCCTGCCGCTTCATGG - Intronic
1102282169 12:111627014-111627036 ATCCCAGCCCTGCTACTGCCTGG - Intergenic
1102717927 12:114990237-114990259 CTTCAGGCCCTGCTCCTGCAGGG - Intergenic
1103782503 12:123408393-123408415 TTACCTGCCCTGCTGGGGCAGGG + Exonic
1104045537 12:125160135-125160157 ATTCCTGCCCTGGTTCTTCATGG + Intergenic
1104408004 12:128534519-128534541 CTTCCAGCCCTGCTTCTGGAGGG - Intronic
1104810878 12:131619780-131619802 AAGCCTGCTCTCCTGCTGCAGGG + Intergenic
1105217781 13:18299422-18299444 TTACCTGCCCTGCTGGGGCAGGG + Intergenic
1105239542 13:18597767-18597789 GTTCCTGCCCTCCTGCAGCTGGG + Intergenic
1109462644 13:62682013-62682035 ATTCCTGCCTTGTGGCTACAGGG + Intergenic
1112041397 13:95552312-95552334 TTTCCTGCTCTGCTTCTACAAGG + Intronic
1112560201 13:100506136-100506158 TTTCATGCTCTGCTGCTGCCAGG + Intronic
1112983085 13:105410763-105410785 AATCCAGCACTTCTGCTGCACGG + Intergenic
1113692882 13:112324177-112324199 TCTCTGGCCCTGCTGCTGCATGG - Intergenic
1116070621 14:40039924-40039946 GAGCCTGCCCTGCTCCTGCATGG - Intergenic
1117072340 14:52068594-52068616 CTGCCTGCCCCGCTGCTGTAGGG - Intronic
1117522005 14:56560276-56560298 ATTCCTGCTCTGCTGCTCGTTGG + Intronic
1120858440 14:89233290-89233312 TTTCCTGTCCTCCTCCTGCAGGG - Intronic
1121399073 14:93656149-93656171 CTTCTTGCCCTTCTGCAGCAGGG + Intronic
1122987838 14:105220788-105220810 TCTCCTGCCATGCTGCTCCAGGG + Intronic
1123151513 14:106186034-106186056 AGCCCTGCCCTGCCCCTGCAAGG + Intergenic
1123491705 15:20786317-20786339 GTTCCTGCCCTCCTGCAGCTGGG - Intergenic
1123493481 15:20800409-20800431 ACCCCCGCCCTGCTGCTCCACGG + Intergenic
1123548207 15:21355411-21355433 GTTCCTGCCCTCCTGCAGCTGGG - Intergenic
1123549989 15:21369511-21369533 ACCCCCGCCCTGCTGCTCCACGG + Intergenic
1124653581 15:31489807-31489829 ATTCCAGCCCTGCTGTTGAGGGG - Intronic
1125645600 15:41269900-41269922 ATTTCTGCCATGTTGCTGAAGGG - Intronic
1125881744 15:43201589-43201611 GTTGCTGCCCTGATCCTGCAGGG - Intronic
1126681308 15:51204888-51204910 ATCCCTAACTTGCTGCTGCAGGG - Intergenic
1128548574 15:68583518-68583540 CTTCCTGTCCTGCTGGTGCCTGG + Intronic
1128667048 15:69546177-69546199 AATCCTGACATGCTGCAGCATGG + Intergenic
1128925352 15:71650433-71650455 ATGCCTGCACTGCTGGTCCATGG + Intronic
1129136826 15:73561196-73561218 ATTCTGGCCCTGCTGCTACCTGG + Intronic
1130026770 15:80277054-80277076 ATTCCTGCTATGCTGGTGCTGGG - Intergenic
1132408143 15:101557206-101557228 GTTTCTGCCCTGCTCCTTCACGG - Intergenic
1202956539 15_KI270727v1_random:82641-82663 GTTCCTGCCCTCCTGCAGCTGGG - Intergenic
1202958319 15_KI270727v1_random:96729-96751 ACCCCCGCCCTGCTGCTCCACGG + Intergenic
1134690028 16:16185020-16185042 AATCCTTCCCGGCAGCTGCAGGG + Exonic
1136030735 16:27500963-27500985 ATGCCTGCACAGCTGCTGCTTGG + Intronic
1137237956 16:46631054-46631076 ATGCCTGACCTGCTTCTGCAGGG - Intergenic
1139378921 16:66518044-66518066 ATTCCCGACCTCCTGCTGCCTGG + Intronic
1139680180 16:68555360-68555382 ATCCCTCCCCTGTTCCTGCAGGG + Intronic
1140305299 16:73797355-73797377 TTTCCTGACCTGCTCCTGTAGGG + Intergenic
1141111764 16:81275964-81275986 GGCCCTGCCCTGGTGCTGCAGGG + Intronic
1142236939 16:88926874-88926896 GGGGCTGCCCTGCTGCTGCAAGG - Intronic
1142263326 16:89052457-89052479 TTACCTGCGCTGCTGCTGCCAGG + Intergenic
1142428589 16:90013786-90013808 ATTCCTGCCCTTCTGAGGGACGG + Intronic
1142610820 17:1108626-1108648 ATTCCTGCCCACCCGCTCCAGGG + Intronic
1143786193 17:9257532-9257554 ACTTCTGCCCTGTAGCTGCAGGG + Intronic
1144498511 17:15765467-15765489 ACCACAGCCCTGCTGCTGCAGGG + Intergenic
1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG + Intronic
1145161895 17:20580508-20580530 ACCACAGCCCTGCTGCTGCAGGG + Exonic
1146207534 17:30917858-30917880 CTTCCAGCCCTGCTGCAGCTTGG + Intronic
1146396737 17:32473808-32473830 AGTCCTTCTCTTCTGCTGCATGG - Exonic
1146401483 17:32503373-32503395 AGTCCTGCCTGGCTTCTGCAGGG - Intronic
1146794941 17:35774235-35774257 CTTCCGGCCATGCTGCTGCCGGG - Intronic
1146890752 17:36505129-36505151 ATGCCTGCCCTGCCACAGCAAGG + Intronic
1147587792 17:41662689-41662711 CTTCCTTCCCTGCTGCTGTTAGG + Intergenic
1148148867 17:45384362-45384384 ACTGCTGCCCTTCTGCTGCCAGG - Intergenic
1148204051 17:45768519-45768541 GGTCCTGCCCTGGTGCTGGAGGG + Intergenic
1149436413 17:56637350-56637372 ATTCCAGCCCTTCTCCTGCAAGG + Intergenic
1151332668 17:73420083-73420105 ATGCCCGCCCTGCTCCTGCCTGG - Intronic
1152307521 17:79529917-79529939 ATGGCTGCCTTCCTGCTGCATGG + Intergenic
1152877171 17:82793510-82793532 TTTCCTGCCCTGCTGCTGAGGGG + Intronic
1153613299 18:6909745-6909767 ATTCCTCCCCTGCTCCCCCAGGG - Intronic
1153628940 18:7050411-7050433 ATTCTTGCCCTGGTGCTGTGGGG + Intronic
1153724634 18:7942490-7942512 ATTCCTGCCCTCCAGATACAGGG + Intronic
1154475100 18:14747894-14747916 ATTCCCGCCCTCCTGCAGCTGGG - Intronic
1155158650 18:23178285-23178307 GGCCCTGCCCTGCTGCTGTAGGG - Intronic
1155527925 18:26736077-26736099 ATTCCTGCCTAGGTGCAGCAAGG + Intergenic
1157627145 18:49060555-49060577 ATGCCTGACCTGGGGCTGCATGG - Intronic
1158318778 18:56240799-56240821 ATTCCTGCCATGCTGTTTTATGG + Intergenic
1158774835 18:60564792-60564814 TTTCCTGCCCTGCTGCAATAGGG + Intergenic
1161400339 19:4064466-4064488 AGCCCAGCCCTGCTGCTGCCAGG - Intronic
1161780826 19:6290833-6290855 ATACCTGCCCTGAAGCTTCACGG + Intergenic
1162689188 19:12414511-12414533 AGGCCTTCCCTCCTGCTGCAGGG - Intronic
1163697561 19:18771706-18771728 GTTCCTGCCCTGGTGCAGCCTGG - Intronic
1164142379 19:22484392-22484414 ATTCTTGCTGTGCAGCTGCAAGG - Intronic
1164389505 19:27805773-27805795 GTTCCAGCCCTGCTTCAGCACGG + Intergenic
1164739386 19:30565249-30565271 CTGCCTGCCCTGCTTCTTCAAGG + Intronic
1165746884 19:38234722-38234744 GTTGCTGCCCTGATACTGCATGG - Intergenic
1166006823 19:39913898-39913920 ATTCTTGCTCTGCAGCTGCTGGG + Exonic
1168629921 19:57948584-57948606 ACTTATGTCCTGCTGCTGCAGGG - Intergenic
925571069 2:5313471-5313493 ATTCCTGCCCTGCTCTTAGAGGG - Intergenic
926075522 2:9939754-9939776 ACTCCTGGCCTCCTGCTGCGAGG - Intergenic
926494049 2:13561888-13561910 ATACCTGCCCTGGTGCTGGTGGG + Intergenic
928028137 2:27756291-27756313 ATTCCTGGACTGCTCCAGCATGG + Intergenic
928819081 2:35339051-35339073 ATTTCTGCCCTGCTAGGGCAAGG - Intergenic
930053332 2:47233976-47233998 TGTCCTGCCCTGCTCCTTCAGGG + Intergenic
932788309 2:74628922-74628944 ATTACTATCCTGCTGCTTCATGG + Intronic
932953277 2:76318645-76318667 TATCATGCCATGCTGCTGCATGG - Intergenic
934296528 2:91747227-91747249 TTACCTGCCCTGCTGGGGCAGGG - Intergenic
934657218 2:96122685-96122707 AGCCCTGCCCTGCTGCTTCTTGG + Intergenic
934897755 2:98133228-98133250 ATTCCTAACCTGCTGCTCCTTGG + Intronic
935046957 2:99490679-99490701 ATTCGTGGCCTGCTCCCGCAGGG + Intergenic
937260184 2:120580503-120580525 GTGCCTGCTCTGCTCCTGCAGGG - Intergenic
938292533 2:130157687-130157709 CTCCCAGCCCTGCTTCTGCACGG + Intronic
938580647 2:132643426-132643448 ATTCCTTGCCTGCTGTTGGAGGG - Intronic
939909401 2:147962375-147962397 CAACCTGCCCTGCTGCAGCATGG + Intronic
941693834 2:168529636-168529658 ATTCCTGTCATTCTGCTCCAAGG - Intronic
942882774 2:180883021-180883043 ATCCCACCACTGCTGCTGCAGGG + Intergenic
944429433 2:199617193-199617215 ATTTCTGCTCTGTGGCTGCAGGG + Intergenic
945194094 2:207222114-207222136 ATTCTTTCCTTGGTGCTGCAAGG - Intergenic
948352353 2:237351191-237351213 ATTCCTCCCCTCCTGCTCCAGGG - Exonic
948444163 2:238019319-238019341 GTTCCTACCCTGCTTCTGTAGGG + Intronic
948698166 2:239744223-239744245 ATTCCTGGCCTCCAGGTGCATGG - Intergenic
948945160 2:241215629-241215651 ATCCGTGCCCTGCTCCTGCCAGG - Intronic
1169424435 20:5485238-5485260 AGGCCTGCCCAGCAGCTGCAGGG - Intergenic
1173293924 20:41739060-41739082 AATCCAGCCTTGCTGCTGGAGGG - Intergenic
1173503802 20:43571722-43571744 CTTCCTGCCCAGCTGCCACAAGG + Intronic
1173737255 20:45370960-45370982 ATCCCTGCCCTGCCGCTACCTGG + Intronic
1174780156 20:53382248-53382270 ATTCCTTCCCTGCTGGTGCTGGG + Intronic
1175929054 20:62485032-62485054 CTTACTGCCCTGCTGGTGCAGGG - Intergenic
1176221294 20:63970308-63970330 AATCCTGCGCTGCCGGTGCACGG - Intronic
1176240547 20:64073881-64073903 TACCGTGCCCTGCTGCTGCAGGG - Exonic
1176446921 21:6829525-6829547 GTTCCTGCCCTCCTGCAGCTGGG + Intergenic
1176825092 21:13694551-13694573 GTTCCTGCCCTCCTGCAGCTGGG + Intergenic
1179578509 21:42322700-42322722 TCTCCTGGCCTGCTGCTCCAGGG + Intergenic
1179999544 21:44989117-44989139 CTGCCTGCCCTGCTGCTCCCCGG + Intergenic
1180688801 22:17693097-17693119 ATTCCTGCCTTGCTGCTTTCCGG + Intronic
1181027578 22:20134682-20134704 ACTCCTGCCCACCTGGTGCATGG - Intronic
1181545401 22:23599488-23599510 ATTCCTTCCATTCTGCCGCATGG - Intergenic
1181814905 22:25430411-25430433 ATTCCTTCCATTCTGCCGCATGG + Intergenic
1182987477 22:34734108-34734130 ATTCTTGCCCTGATGAAGCATGG + Intergenic
1183078920 22:35443906-35443928 ATCCCTGCCCTGCTGTTACTGGG + Intergenic
1183214141 22:36468218-36468240 AGCCCTGGCCTGCAGCTGCAAGG - Intronic
1184098454 22:42329225-42329247 ATTCCTCCCTTCCTGCAGCAAGG + Intronic
1184410686 22:44324444-44324466 GTTCCTGCCTGGCTGCTTCATGG + Intergenic
1184582078 22:45424665-45424687 ATTCCTTCCCTCCTCCTGCAGGG - Intronic
1184645761 22:45894173-45894195 ATTCCTGTCCGGCTTCTGTAGGG - Intergenic
1184981553 22:48099344-48099366 AGTCCTGGCTTGCGGCTGCATGG - Intergenic
1185194625 22:49461469-49461491 ATTCCTTCCCTGCTTATGCCAGG - Intronic
949168652 3:971693-971715 ATTCCTCCCATGTTGCTCCATGG + Intergenic
949994161 3:9603051-9603073 ATTTCTCCCATGCTGCTGCAGGG - Intergenic
950171087 3:10839526-10839548 ACTCCTTCCCTGCTTCTCCAAGG + Intronic
950477563 3:13223563-13223585 TTTCCTGCCCTTCTGCTGGGAGG - Intergenic
952557628 3:34550954-34550976 TTTCCTGAGCTGCTTCTGCAAGG - Intergenic
952818771 3:37468118-37468140 GTTCCAGCCCTGCTTCTGCTTGG + Intronic
953343584 3:42156313-42156335 TTTCCTCCCCTCCTGCTGCAAGG - Intronic
953432674 3:42852615-42852637 ACTCCTGCCCTGCTGAGGAATGG + Intronic
954131502 3:48563553-48563575 ATTCCTGCCCTTCTGTTTCCTGG - Intronic
954263999 3:49459497-49459519 CTTCCTCACCTGCTGCTGCCAGG - Intergenic
954444614 3:50540065-50540087 ATCCCTGCCCTGCTGGAGCCTGG + Intergenic
954447119 3:50552783-50552805 ATCCCTGCCTCGCGGCTGCACGG + Intergenic
956262340 3:67357924-67357946 ATTCCAGGCCTACAGCTGCAAGG - Intergenic
959609243 3:108275903-108275925 TTTTTTGCCATGCTGCTGCAAGG - Intergenic
960219498 3:115088164-115088186 ATTCATGCTCTGCTGCTAAAGGG + Intronic
961173399 3:124815230-124815252 GTGCCTTCCCTGCTGCTGCAAGG + Intronic
961174345 3:124821517-124821539 AGTCCTGCCCTGGTCATGCAGGG + Intronic
961357203 3:126346648-126346670 ATTCCCTCCCTGCTGCCACAGGG + Intronic
961487528 3:127227301-127227323 CTTCCTGCCCTGGAGCTGCGAGG - Intergenic
961672840 3:128547495-128547517 TCTCCTTCCCTGTTGCTGCAGGG - Intergenic
962887393 3:139640095-139640117 AAACCTGTCCTGCTGGTGCATGG - Intronic
965541650 3:169877624-169877646 ATTTCTCCCCTGCTGCTCTATGG + Intergenic
966198493 3:177337180-177337202 ATTTCTGCCTTGCAGCTGCCTGG - Intergenic
966595650 3:181722971-181722993 TTGGCTGTCCTGCTGCTGCAAGG + Intergenic
969319469 4:6403030-6403052 ATTACTGCCCTCCTGCCGCCTGG - Intronic
972587521 4:40451465-40451487 ATTCCGACCCCGCTGCTACATGG + Intronic
972679380 4:41290673-41290695 GTTCCTGCCATTCTGCAGCAGGG - Intergenic
974098722 4:57393903-57393925 AGTCCTTCCCTGCTGCTGCTGGG + Intergenic
975692420 4:76978994-76979016 ATCACTGCACTGCTGCTCCATGG + Intronic
975714968 4:77196897-77196919 CTTGCTGGCCTGCTGCCGCAAGG + Intronic
976483587 4:85573484-85573506 GTCCTGGCCCTGCTGCTGCATGG - Intronic
977736446 4:100422315-100422337 ATTACTGACCTGCTGATTCACGG - Intronic
979051981 4:115946214-115946236 TTTCCTGCCCTTCTGGAGCAGGG + Intergenic
985519069 5:362617-362639 GGTCCTGCCCTGATGCTGTAAGG + Intronic
987224075 5:15821470-15821492 ATTCCACCCCTGCTGCTGAATGG + Intronic
988519293 5:31931507-31931529 ACTCCTGCCCAGCTGCAGCTGGG - Intronic
989213483 5:38880360-38880382 TTTCCTGCCCCACAGCTGCAAGG - Intronic
989276822 5:39599037-39599059 GTTCGTCCCCTGCTGGTGCAGGG - Intergenic
990309666 5:54525991-54526013 ATACCTGGCCTGCTGCTGCCTGG + Intronic
990899920 5:60739113-60739135 ATTCATGACCTGCTGATGGAAGG + Intergenic
991418926 5:66421148-66421170 ACTCCTGCCCCTCTGCTGGAGGG + Intergenic
992073618 5:73171562-73171584 ACTCCAGCCTTGCTGCTCCAAGG + Intergenic
993370161 5:87083465-87083487 ATTCCTTCCCTGTTGTTGGAGGG + Intergenic
994746484 5:103684958-103684980 ATTCCTACCCTACTGCTTCCAGG - Intergenic
994930803 5:106181776-106181798 ATTCATGACCTGCTTCTGCCTGG - Intergenic
995264172 5:110138912-110138934 ATTCTTCCCCTGCTGGTGCTGGG - Intergenic
995660558 5:114478117-114478139 AATCTATCCCTGCTGCTGCAAGG + Intronic
996636970 5:125703738-125703760 ATTCCTTCCCTGGAGCAGCATGG + Intergenic
996981329 5:129498975-129498997 ATTACTTGCCTACTGCTGCATGG + Intronic
997383848 5:133457189-133457211 ATTCCCTCCCTGTGGCTGCAGGG + Intronic
997560162 5:134839603-134839625 ATTCATACCCTGCAGCTGAAGGG + Intronic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
999432521 5:151536511-151536533 ATTCCTGCCCTGCTGCTGCAGGG - Intronic
999443368 5:151620072-151620094 CTGCCTGCCCTCCTGCTGCTGGG - Intergenic
999446684 5:151646020-151646042 ATTCATCCTCTGCTGCTTCAGGG - Intergenic
1001024958 5:168216201-168216223 TTTCCAGCCCTGCTGCAACAGGG + Intronic
1001102164 5:168823361-168823383 GTGCCTCCCCTGCTGCTGCCTGG - Intronic
1002047997 5:176552832-176552854 GTTCCTGCCCAGCAGCTCCAAGG - Intronic
1003323483 6:5073924-5073946 CTTCCTGTCATGCTGCTGCTTGG + Intergenic
1003846278 6:10177023-10177045 ATTCCAGACTTGCTACTGCAAGG + Intronic
1004292675 6:14382745-14382767 TTGCCTGCCCTCCTTCTGCATGG + Intergenic
1004817528 6:19328751-19328773 ATTCCTACACTGCTGCTTCAGGG - Intergenic
1004881921 6:20017240-20017262 TTGCCTGCCCTGCTGCTGGCTGG - Intergenic
1006255437 6:32829020-32829042 ATTCCAGTCCTGCAGCTGAAGGG + Intronic
1007255233 6:40523776-40523798 ATTCCTGCTCTGCTGCAGGCTGG - Intronic
1007414976 6:41686236-41686258 TTGCCTGGCCTGCTGCTGCAGGG - Exonic
1008540856 6:52545534-52545556 ATTCCTCCCCTACTCCTGCAAGG - Intronic
1010830933 6:80528151-80528173 ATTCTTGCCATGGTGCTCCAGGG + Intergenic
1011405480 6:87011262-87011284 AGTCATTCCCTCCTGCTGCAAGG - Intronic
1015820660 6:137257210-137257232 GTTCCTGCCCTGCTGCAGTGTGG + Intergenic
1016387848 6:143545618-143545640 ATTCCTTCCCTGCTGCCTGAGGG - Intronic
1019219443 6:170462733-170462755 ATTCCTGCCTTGGGGCTGCTTGG + Intergenic
1019595730 7:1857542-1857564 GTTTCTGCCCTGCTGCGGCTGGG + Intronic
1019597604 7:1865389-1865411 ATCCCAGCCCTGCTGCTGCCCGG + Intronic
1019606312 7:1911957-1911979 ACTTCTGCCCTGCAGCTGCATGG - Intronic
1021604691 7:22397936-22397958 TTTCCTGCTTTGCTGCTGCCAGG - Intergenic
1021866905 7:24967309-24967331 ATTCTTACCCTACAGCTGCAAGG + Intronic
1023092008 7:36625860-36625882 CTTCCTGCTCTGATGCTCCAGGG + Intronic
1024517791 7:50274568-50274590 ACTCCTGCCTTGCTGCTGAGGGG - Intergenic
1024825941 7:53389255-53389277 ATTCCTTCCCTCCAGCTACAGGG - Intergenic
1025208533 7:57007795-57007817 CTTCATGCCACGCTGCTGCAAGG - Intergenic
1025663415 7:63569083-63569105 CTTCATGCCACGCTGCTGCAAGG + Intergenic
1026370304 7:69691771-69691793 GTGCCTCCCCTGCTGCAGCATGG + Intronic
1026435326 7:70391934-70391956 TTCCCTGACCTGCTCCTGCATGG + Intronic
1028420917 7:90631904-90631926 ATTACTGTCCTGCTGCAACATGG - Intronic
1028835514 7:95370274-95370296 ATGCCTTCCCTGATTCTGCATGG - Intronic
1030689042 7:112514017-112514039 GTTCCTGCCTTACAGCTGCATGG - Intergenic
1032503788 7:132420333-132420355 ATTCCTGAGCTGCTGGTCCAGGG + Intronic
1033602713 7:142899777-142899799 CTTCCTGCCTGGCAGCTGCAAGG - Intergenic
1034542210 7:151765503-151765525 CTTTCTGCCCTGCAGCTTCAGGG + Intronic
1035727864 8:1835620-1835642 CTTCCCACCCTGCTGCTGGATGG + Intronic
1035760638 8:2066169-2066191 AGTCCTGCCCTGGTCCAGCAGGG + Intronic
1036289520 8:7475118-7475140 ACACCTGCCCTGCTCCTGCCTGG - Intergenic
1036331954 8:7836413-7836435 ACACCTGCCCTGCTCCTGCCTGG + Intergenic
1037579914 8:20238971-20238993 ATTGCTGCCATGCTGGAGCAGGG - Intergenic
1037876659 8:22551948-22551970 ATCCCTGCCCGGCTGCTGCCTGG - Exonic
1039542506 8:38382986-38383008 CTTCCTGCTCTGCTGCGGCCCGG + Intergenic
1042228051 8:66530314-66530336 ACTCCAGCACTGCTCCTGCATGG + Intergenic
1042453701 8:68976202-68976224 ATTACTGGCCTGCTACAGCATGG + Intergenic
1042765708 8:72319594-72319616 ATTCTTGTCCTGCTGCTCCTTGG - Intergenic
1043284296 8:78510099-78510121 ATTCCTACTCTGCTCCTTCATGG + Intergenic
1044898163 8:96915175-96915197 CTTCCTGTCCTGCTACTTCAGGG + Intronic
1049289988 8:141796729-141796751 GCTGCTCCCCTGCTGCTGCAGGG - Intergenic
1049671340 8:143871398-143871420 ATTGCTGGCCTGCTGCTCCCTGG - Exonic
1050636580 9:7619135-7619157 TCTCCTGCCCTGCTGGTGCCTGG - Intergenic
1051126040 9:13806859-13806881 ATTCATGCCCAGATGCTGTAGGG + Intergenic
1052282574 9:26749961-26749983 ATTTCTGACCTGTTGCAGCATGG + Intergenic
1052976937 9:34418275-34418297 AATCCTGCTCTGCTTCTTCATGG + Intronic
1053424848 9:38004040-38004062 CTGCCTGCCCTGCTCCTGCCTGG + Intronic
1054827242 9:69585601-69585623 AGTCCTGACCTGCTGCTGGTGGG + Intronic
1055017927 9:71639128-71639150 ATTCCTGTGCTGCTGGTCCATGG - Intergenic
1058510617 9:105713217-105713239 ATCCCTGACCTGCCGCTCCACGG + Intronic
1059268759 9:113059924-113059946 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1059269895 9:113065373-113065395 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1059271029 9:113070821-113070843 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1059272162 9:113076267-113076289 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1059273297 9:113081709-113081731 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1059274433 9:113087155-113087177 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1060335290 9:122716395-122716417 CCTCCACCCCTGCTGCTGCATGG + Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062405153 9:136392699-136392721 TTCCCTGCCCTGCTTCTCCAGGG + Exonic
1062473223 9:136715201-136715223 ATCCCTGACCTGCAGCTGAAGGG - Intronic
1203522269 Un_GL000213v1:55006-55028 GTTCCTGCCCTCCTGCAGCTGGG - Intergenic
1203452940 Un_GL000219v1:137601-137623 TTTCCTGCCCTGCCCCTTCATGG - Intergenic
1203655137 Un_KI270752v1:16523-16545 ATTTCTGCATTGCTCCTGCAGGG + Intergenic
1186197231 X:7121452-7121474 ATTCCTTCCCTGGAGCTTCAGGG + Intronic
1188516960 X:30998227-30998249 AGTCCTCGCCTGCTGTTGCAAGG - Intergenic
1190752526 X:53374705-53374727 ATTGTTGCCTTGCTGCTTCATGG + Exonic
1191112225 X:56812900-56812922 CTTCCAGGCCTGGTGCTGCAAGG - Intergenic
1191213808 X:57915396-57915418 TCTACTGCCCTGCTTCTGCAAGG - Intergenic
1191965827 X:66757223-66757245 CATTCTGCCCTGTTGCTGCATGG + Intergenic
1192592183 X:72369541-72369563 TTGTCTGCCCTTCTGCTGCATGG - Intronic
1194199998 X:90942721-90942743 ATTTCTGGCCTGCTGCAGTATGG + Intergenic
1197595039 X:128454549-128454571 ATCCATGCCATGCTGATGCAAGG + Intergenic
1197734446 X:129840356-129840378 ATTCCTGTCCTGCTTCTTCTTGG - Intronic
1200304221 X:155008361-155008383 ACTCTTGCCTTTCTGCTGCAGGG - Intronic
1200545990 Y:4519121-4519143 ATTTCTGGCCTGCTGCAGTATGG + Intergenic
1201065363 Y:10090767-10090789 GGTGCTGCCCTGCTGCTGCACGG + Intergenic