ID: 999432729

View in Genome Browser
Species Human (GRCh38)
Location 5:151538105-151538127
Sequence AAAGAGAAGCAGAGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5663
Summary {0: 1, 1: 2, 2: 62, 3: 738, 4: 4860}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999432729 Original CRISPR AAAGAGAAGCAGAGAGAGGG AGG Intronic
Too many off-targets to display for this crispr