ID: 999434297

View in Genome Browser
Species Human (GRCh38)
Location 5:151551177-151551199
Sequence GGATGATGGTTGGGTAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999434297 Original CRISPR GGATGATGGTTGGGTAAGTG GGG (reversed) Intronic
901508285 1:9700532-9700554 GGATTCTGGATGAGTAAGTGAGG + Intronic
903473063 1:23600723-23600745 GGATGAGTGGTGGGTTAGTGTGG - Intronic
904564296 1:31418719-31418741 GGGTGTTGGGTGGGTAAGGGAGG - Intronic
904767205 1:32859401-32859423 GGGTGAAGGTTGGATAAGCGTGG + Intergenic
905337237 1:37253461-37253483 GGGTGGTGGTGGGGTCAGTGGGG - Intergenic
905690782 1:39941161-39941183 GGATGTTGGTTGGGCAATAGTGG - Intergenic
912983141 1:114397722-114397744 GGATGATGGTGAGGTAACTGAGG - Exonic
914847865 1:151292746-151292768 GGTGGATGGTTGGGTAGGTGGGG + Exonic
915070999 1:153266916-153266938 GGAAGGTGGAAGGGTAAGTGTGG - Intergenic
915488969 1:156241130-156241152 GGTTGGTGGGTGGGTGAGTGAGG + Intronic
916839610 1:168585982-168586004 GGTTGAAGGTTGGGTGGGTGGGG + Intergenic
917613308 1:176711853-176711875 GGACGGTGGTTGGGTAAATCTGG - Exonic
918180141 1:182080340-182080362 GGATGATAGTGGAGGAAGTGTGG + Intergenic
918429126 1:184440084-184440106 AAATGATGGTTGGGAAAGGGTGG + Intronic
922641761 1:227239493-227239515 AGATGAAGATTGGGTAAGTGTGG + Intronic
923732091 1:236561663-236561685 GGATGATGGTTTTGTTTGTGGGG - Intronic
924730822 1:246710165-246710187 GGAAGAGGGAAGGGTAAGTGAGG + Intergenic
1063138792 10:3238916-3238938 GGACGATGTTTGTGTAAGAGAGG - Intergenic
1063247811 10:4241089-4241111 GGATGATTGTTGTTTCAGTGTGG - Intergenic
1065851072 10:29789830-29789852 GAATGATGGGTGGCTACGTGGGG - Intergenic
1067719818 10:48719843-48719865 GGATGATGGTTGAGGCTGTGAGG + Intronic
1067902129 10:50253106-50253128 GGAAGATGGCTGGGGAAGTCTGG - Intergenic
1072565076 10:96610530-96610552 GGATGGTGGGTGGGTGGGTGTGG + Intronic
1072695478 10:97599997-97600019 GGATGAGGGCCGGGTAAGTGTGG - Intronic
1074612641 10:115036828-115036850 GGATGTTGGTTCGGGAAGAGGGG + Intergenic
1074898094 10:117794256-117794278 TGATGATGGGTGTGTAGGTGGGG + Intergenic
1075487676 10:122838988-122839010 GGGTGAAGGTTGTGTAAATGAGG + Intronic
1075789817 10:125076154-125076176 GGATGATAGTGGGGTAATGGGGG - Intronic
1076315232 10:129535140-129535162 GGCTGATGGTTGGGTTGGAGTGG + Intronic
1077126999 11:944611-944633 GGAAGGTGATTGGGTAAATGAGG + Intronic
1078511342 11:11986432-11986454 GGAAGATGGTTAGGAAACTGTGG - Intronic
1079115776 11:17639735-17639757 TGATGATGGTGGGGACAGTGAGG + Intronic
1079497732 11:21064654-21064676 GGAGGAAGGATGGGAAAGTGGGG + Intronic
1079622849 11:22575719-22575741 GGAGGTTGATTTGGTAAGTGTGG - Intergenic
1082983105 11:59142605-59142627 TGAGGCTAGTTGGGTAAGTGGGG - Intergenic
1083755047 11:64787857-64787879 GGACCAGGGTGGGGTAAGTGGGG - Intergenic
1084785715 11:71440598-71440620 GGATGATGGGTGGGTGGATGTGG + Intronic
1086639976 11:89141688-89141710 AGATGAGGGGTGGGTAATTGAGG + Intergenic
1089143588 11:116308029-116308051 GCATGATGGTTTGGGATGTGGGG - Intergenic
1089422065 11:118339403-118339425 GAATGAAGGGAGGGTAAGTGGGG - Intronic
1089582469 11:119489903-119489925 GGCTGATGGATTGGTGAGTGGGG - Intergenic
1089967379 11:122664551-122664573 GGAGGATGGGTGGGTAGATGTGG + Intronic
1091176742 11:133565438-133565460 AGATGATGGTGGAGTAAGAGGGG - Intergenic
1091301559 11:134511036-134511058 GGAGGCTGGTTGTGTATGTGTGG + Intergenic
1091601348 12:1919329-1919351 GGATGATGTTTGGGTGGCTGAGG + Intergenic
1092166159 12:6343578-6343600 AGAAGATAGTTGGGTAAATGTGG - Intergenic
1093995853 12:25642034-25642056 GGAGTATGGTTGGGTTAATGAGG - Intronic
1096400463 12:51301896-51301918 GAATGAAGTTTGGGTAAGTTAGG - Intronic
1096499818 12:52057873-52057895 AGGCGCTGGTTGGGTAAGTGCGG - Intronic
1096575214 12:52548576-52548598 GGGAGATGGTTGGCTAACTGAGG + Intronic
1097266195 12:57746334-57746356 GGATGATCTTTGGGTAGTTGGGG - Intronic
1097442836 12:59632457-59632479 GGACTAGGGTTGGGTAAGGGAGG + Intronic
1099569841 12:84303271-84303293 GGATGAGAGTTTGGTAAGAGAGG + Intergenic
1101049286 12:100844494-100844516 GGATGAGAGTTGGGGAAGTGGGG + Intronic
1103339215 12:120212271-120212293 GGATGCTGGCTGGGGAAGGGGGG + Exonic
1106043269 13:26114263-26114285 GAATGATGGCTGGGCAGGTGTGG + Intergenic
1108116068 13:47129468-47129490 GGATGCTGGTTGGGTATTTTTGG - Intergenic
1108942949 13:55980525-55980547 GGATGGAGGTTGGGGGAGTGGGG - Intergenic
1108985625 13:56583598-56583620 GGATGGTGGTTGGGGTAGGGGGG - Intergenic
1112623163 13:101073098-101073120 GGATGATGCTTGGGGAAGACAGG + Intronic
1113560023 13:111271323-111271345 GGAAGATGGGTGGGGAACTGAGG - Intronic
1113569194 13:111341906-111341928 GGCTGATGGATGGGGCAGTGAGG + Intronic
1113667935 13:112153893-112153915 GCGTGAGGGTTGGGTGAGTGTGG + Intergenic
1114348549 14:21823827-21823849 GGATGATGGGTTGATAAGTACGG + Intergenic
1117643127 14:57821903-57821925 GGAATAGGGTTGGATAAGTGAGG + Intronic
1118345745 14:64939529-64939551 TGTTGATGGTTGGGAAGGTGCGG + Exonic
1120673676 14:87393597-87393619 TTATGATGCTAGGGTAAGTGAGG - Intergenic
1121291554 14:92779924-92779946 GGATGGTGGGTGGGAAAGGGAGG - Intergenic
1122879874 14:104685927-104685949 GGCAAATGGGTGGGTAAGTGGGG + Intergenic
1123979784 15:25590093-25590115 GGAAGATGGTGGGGAGAGTGGGG + Intergenic
1125215139 15:37263528-37263550 GTTGGATGGTTGGGTAAGTGAGG - Intergenic
1127263252 15:57341196-57341218 AGATGATGGTGGGATAGGTGTGG + Intergenic
1128518842 15:68362006-68362028 GTATGGTGGGTGGGTGAGTGGGG - Intronic
1129006054 15:72374832-72374854 GGATGAGGGTGGGGAAAATGTGG - Intronic
1133141988 16:3751924-3751946 GGTTGATTGATGGGTCAGTGAGG + Intronic
1133383198 16:5348017-5348039 GGTTGATGGGTGGGTAGGTGGGG - Intergenic
1134106123 16:11486867-11486889 GGATGATGGGTGGGGGGGTGGGG + Intronic
1135261254 16:20982962-20982984 GGATTCTGGTGGGGTAAGTGGGG + Intronic
1135374507 16:21934181-21934203 GGATGAGGGTGGGGTGAGAGGGG - Intergenic
1136113485 16:28079632-28079654 ACCAGATGGTTGGGTAAGTGGGG + Intergenic
1139243858 16:65421454-65421476 GGAAGATGGCTGGGTATGTATGG + Intergenic
1140420341 16:74814055-74814077 GCATGATCGTAGGGTAAGTGGGG + Intergenic
1140430965 16:74902680-74902702 GGCTCATGGTTGGGTACATGTGG - Intronic
1141762707 16:86039082-86039104 GGGTGGTGGGTGGGTGAGTGGGG + Intergenic
1142656664 17:1399433-1399455 GGATGATGGTGGGGGGAGAGGGG - Intronic
1143163321 17:4885331-4885353 GGATGGTGGTGGGGTAAAGGAGG + Intronic
1143239402 17:5431149-5431171 AGACCATTGTTGGGTAAGTGAGG + Intronic
1143751405 17:9030774-9030796 GAAAGATGGTTCTGTAAGTGTGG + Intronic
1144049924 17:11489864-11489886 TGATGGTGGTTGGGGAAGGGGGG - Intronic
1144168368 17:12634344-12634366 GGATTAGGGTGGGGCAAGTGAGG + Intergenic
1148144227 17:45352404-45352426 AAATGAGGGTTGGGGAAGTGGGG + Intergenic
1148447171 17:47744827-47744849 GGATACTGGTTGGGTAGGAGAGG - Exonic
1149517082 17:57288824-57288846 GGGTGGAGGTTGGGGAAGTGGGG + Intronic
1149856402 17:60086951-60086973 GGATGAGGGTGAGGCAAGTGAGG + Intergenic
1150814750 17:68384224-68384246 GGATGAGGGTGGGGTGTGTGTGG + Intronic
1151060655 17:71089893-71089915 GCATGATGGTTCTGTTAGTGAGG + Intergenic
1152242578 17:79168027-79168049 GGGTGAGGGGTGGGTAACTGGGG + Intronic
1152387677 17:79984888-79984910 GGAGGATGGTGGGGTGGGTGGGG - Intronic
1152541807 17:80980329-80980351 GGATGTTGGGTGGGTAGTTGAGG - Intergenic
1155329466 18:24699884-24699906 GGATGGGGGTAGGGTAAGGGAGG + Intergenic
1157565376 18:48675830-48675852 GGATGGGGGCTGGCTAAGTGGGG + Intronic
1158167691 18:54558738-54558760 AAATGATTGTTGGATAAGTGAGG + Intergenic
1158411911 18:57213502-57213524 GAATGATGCATGGGTGAGTGTGG + Intergenic
1159910218 18:74138627-74138649 GGATGATGGATGTGTCAGTCTGG - Intronic
1161327072 19:3669116-3669138 GGCTGAGGGTTGGGGAAGGGAGG + Intronic
1161347839 19:3776951-3776973 GGATGGTGATTGGGTGGGTGTGG + Intergenic
1164441473 19:28283333-28283355 AGATGATGGTGGGGGGAGTGGGG - Intergenic
1166509130 19:43392479-43392501 GGATGAGGGTGAGGTAAGTGAGG - Intergenic
1167194672 19:48019887-48019909 GGATGGGGGTTGGGTGGGTGTGG + Intronic
1167262741 19:48468184-48468206 GGAGGATGCTTGGGGAAGGGAGG + Intronic
925001993 2:410373-410395 GGATGATGGTGTGGACAGTGAGG - Intergenic
926743871 2:16134840-16134862 GGATGGGGGTGAGGTAAGTGAGG + Intergenic
927128682 2:20038179-20038201 GGAGGTTGGGTGGGGAAGTGAGG - Intronic
928059959 2:28101881-28101903 GGATTATGATTCAGTAAGTGTGG - Intronic
929449110 2:42024962-42024984 GGATGATGGTGGGGTAAAGGAGG - Intergenic
930775749 2:55168480-55168502 GGATGAGGGTGGGGTGAGTGGGG - Intergenic
931067976 2:58608961-58608983 GGCAGATGGTTGAGTAAATGTGG + Intergenic
931231075 2:60375392-60375414 GGATGAGAGGTGGGGAAGTGAGG - Intergenic
933588128 2:84201839-84201861 GAATGATACTTCGGTAAGTGAGG + Intergenic
939078448 2:137630477-137630499 GTGTGATGGTTAGGGAAGTGTGG - Intronic
940515840 2:154683084-154683106 AGATGGTGGATGGGTAAGAGAGG - Intergenic
941664102 2:168226602-168226624 GTGGGATGGTTGGGTAATTGTGG - Intronic
941751681 2:169141296-169141318 GGATGAGGATGGGGTGAGTGGGG - Intronic
944452102 2:199853543-199853565 GGATGAAGGTAAGGTCAGTGAGG + Intergenic
945267508 2:207905397-207905419 GGCTGGTGGTTGGGTCAGTTAGG + Intronic
946546933 2:220753966-220753988 AGATGATGGTTTGGTCAGTCTGG + Intergenic
1170589653 20:17762187-17762209 GGATGAGGGTGAGGTGAGTGAGG + Intergenic
1171490110 20:25510816-25510838 GCAGGATGTTTGGGGAAGTGGGG + Intronic
1173426921 20:42951294-42951316 GGATGATGGATGAGTAGATGGGG + Intronic
1173576929 20:44118337-44118359 GGATGATGCAGGGGTAGGTGGGG - Intronic
1174368882 20:50073099-50073121 TGATACTGGTTGGGTAGGTGTGG - Intergenic
1175230653 20:57471399-57471421 GGGTGATGCTTGGGTGGGTGAGG + Intergenic
1175329429 20:58153088-58153110 GGATTAGGGTGGGGCAAGTGAGG + Intronic
1175494613 20:59404929-59404951 GGATGGTGGATGGGCAGGTGAGG - Intergenic
1175636900 20:60591980-60592002 GGCTCATGGTTGGGGTAGTGGGG + Intergenic
1177695910 21:24569971-24569993 GGAAGATTATAGGGTAAGTGGGG - Intergenic
1178031400 21:28530400-28530422 GGATAATGGCAGGGTGAGTGAGG - Intergenic
1178683153 21:34690141-34690163 GGGTGAGGGTGGGGTGAGTGGGG + Intronic
1179948480 21:44696483-44696505 GGTTGATGTATGGGTTAGTGAGG + Intronic
1180141374 21:45895506-45895528 GAATGATGGTAGTGGAAGTGAGG - Intronic
1181867312 22:25869070-25869092 GGATTATAGTTTGGGAAGTGGGG + Intronic
1182293718 22:29300966-29300988 GGATGATGGCTGGTTAAGGGAGG - Intergenic
1184604218 22:45562984-45563006 GGATGTTGGTGGGGAAAGAGAGG - Intronic
1185109885 22:48894974-48894996 ACATGAAGGCTGGGTAAGTGTGG + Intergenic
949141103 3:634244-634266 TGATGATGGTTGTGGCAGTGGGG - Intergenic
951265120 3:20556176-20556198 GGCTAATGGTTGGCTAATTGAGG + Intergenic
951965264 3:28375767-28375789 GGGGGATGGTAGGGGAAGTGTGG - Intronic
953019760 3:39106119-39106141 GGATGATGGTAGGGAAAGAAGGG - Intronic
953960037 3:47259516-47259538 AGATAATGGGTAGGTAAGTGTGG + Intronic
955444433 3:58994350-58994372 GTATGATGGCTGGATAAGTGGGG + Intronic
955783395 3:62510086-62510108 GGATGAATGATGGGTAGGTGGGG - Intronic
956020839 3:64931733-64931755 GGGGGATGGTTGGGGAACTGGGG - Intergenic
957556840 3:81773181-81773203 GGTGGATGGGTGGGTAGGTGTGG + Intergenic
957798956 3:85049924-85049946 GGGAGATGGTGAGGTAAGTGGGG - Intronic
958916893 3:100060030-100060052 GGAGGACGGTTGGGGAAATGGGG + Intronic
959479187 3:106850570-106850592 GGATGATGGTTGCACTAGTGTGG - Intergenic
960051240 3:113241308-113241330 GGAGTATGGGTGGGTGAGTGTGG - Intronic
961760260 3:129161956-129161978 GGAGGGTGGTTGGAGAAGTGCGG + Intergenic
961987637 3:131154481-131154503 GGATTAGGGTGAGGTAAGTGAGG + Intronic
962087254 3:132204717-132204739 GGAGGATGGTGGGGGAAGAGAGG + Intronic
964607478 3:158572812-158572834 GGAGGATGGTTGAGGACGTGAGG + Intronic
966169639 3:177064283-177064305 GGAACATGGTTGGGTATGGGTGG - Intronic
968675130 4:1873158-1873180 GGCTGATGGTTGGTAGAGTGAGG + Intronic
970328273 4:14951746-14951768 GGAAGAAGTTTGGGTAACTGGGG + Intergenic
971769396 4:30877167-30877189 GGTTGATGGTTTGGGGAGTGTGG + Intronic
971796230 4:31232295-31232317 GGGTGATGGATGAGGAAGTGAGG - Intergenic
978378187 4:108097439-108097461 GAATGGGGGTTGGGTGAGTGGGG + Intronic
978820878 4:112964304-112964326 GGGTGAGGGTGGGGGAAGTGGGG - Intronic
979271784 4:118770900-118770922 AGATGATGGATAGGTAAGTAAGG + Intronic
981661373 4:147170777-147170799 AGATGATGGGTTGGTAGGTGTGG + Intergenic
982054691 4:151536461-151536483 GGATGATGTATGGGAAAATGGGG - Intronic
986300439 5:6474443-6474465 GGATGAGGCTTGGGTTGGTGAGG + Intronic
986444142 5:7806957-7806979 GGATGAGGGTGAGGTAAGTGAGG - Intronic
992106506 5:73452480-73452502 GAAAGATGGTTGGGGAAATGGGG - Intergenic
992255331 5:74915302-74915324 GGAGTATGGTTGGGTGATTGTGG + Intergenic
992861376 5:80913923-80913945 GGACGGTGGTTGGGGGAGTGGGG + Intergenic
993592399 5:89810035-89810057 GGAGGGTGGTTGGGGAAGTGAGG + Intergenic
993831251 5:92761344-92761366 GAATGATAGATGAGTAAGTGTGG + Intergenic
994154998 5:96493550-96493572 GCATGATGCTTGGGTTGGTGGGG - Intergenic
998323431 5:141255413-141255435 GGATGAGGGTGAGGTCAGTGTGG + Intergenic
999197995 5:149795773-149795795 GGATGATGGTGGGGGCAGGGGGG + Intronic
999434297 5:151551177-151551199 GGATGATGGTTGGGTAAGTGGGG - Intronic
999571211 5:152921767-152921789 GGATGATGGCTGGGTCAAAGAGG - Intergenic
1000172618 5:158717898-158717920 GGTTGATGGTTATGTGAGTGGGG + Intronic
1000791825 5:165617580-165617602 GAATGATGGATGGATGAGTGGGG + Intergenic
1002068995 5:176667744-176667766 GCATGATGTTTGGGTCGGTGGGG + Intergenic
1003978558 6:11367565-11367587 GAATGATGGTGAGGGAAGTGGGG - Intronic
1004457054 6:15801032-15801054 GGGTGATGACTGGGAAAGTGAGG - Intergenic
1004555246 6:16690759-16690781 TGGTGCTGGTTGGGTAACTGTGG - Intronic
1005846013 6:29779239-29779261 GGATGTTGTTTGGGCAGGTGTGG + Intergenic
1006155363 6:32010453-32010475 TGATGCTGGCTGGGGAAGTGAGG + Intergenic
1006161669 6:32043187-32043209 TGATGCTGGCTGGGGAAGTGAGG + Exonic
1006244611 6:32719875-32719897 GGATCATGGTTGGGGAAGGAAGG + Intergenic
1006616019 6:35327469-35327491 TGAGGATGGATGGGGAAGTGGGG + Intergenic
1009219744 6:60969030-60969052 TGATATTGGTTGGGTAGGTGGGG + Intergenic
1010811055 6:80299260-80299282 GGCTGACTTTTGGGTAAGTGGGG - Intronic
1012930402 6:105310499-105310521 TGCTGATGGTTGGGCAAATGAGG - Intronic
1017165885 6:151408084-151408106 GGATGCTGGTGGGGTTATTGGGG + Intronic
1017743332 6:157426246-157426268 GGATGCTGGGTGGGGAGGTGGGG + Intronic
1019407353 7:890491-890513 GGTTGGTTGTTGGGTCAGTGTGG + Intronic
1019921013 7:4163336-4163358 GAATGATGGTTCGGGAAGTCAGG + Intronic
1022414742 7:30168244-30168266 GGATGATGTGTGGGAGAGTGAGG + Intergenic
1023098864 7:36692088-36692110 AAATGATGGTTGTGTAAGTGTGG + Intronic
1023201183 7:37698539-37698561 GGGTTTTGGTTGGGTAACTGGGG + Intronic
1023461839 7:40406107-40406129 GGATGCTGATTGGTTGAGTGGGG + Intronic
1023491833 7:40751250-40751272 GGATGAAAGGTGGGGAAGTGGGG + Intronic
1025610704 7:63073493-63073515 GGTGGATGATGGGGTAAGTGAGG - Intergenic
1027126497 7:75560099-75560121 GGATGATGGCCGGGGAATTGTGG + Intronic
1027352268 7:77324336-77324358 TGCTAATGGTTGGGGAAGTGGGG - Intronic
1027773550 7:82436701-82436723 GAGTGATGGATGTGTAAGTGGGG - Intronic
1031537345 7:122951579-122951601 GAAAGATGCTGGGGTAAGTGAGG - Intergenic
1032089551 7:128904405-128904427 GGAGGATGGTGGGGGAAGGGAGG - Intronic
1038994207 8:32903351-32903373 TGATGGTGGTAGGGCAAGTGAGG - Intergenic
1039162993 8:34643452-34643474 TGAGGATGGTGGGGTAGGTGGGG + Intergenic
1039243399 8:35581465-35581487 GGGTGATGGTGGAGGAAGTGGGG + Intronic
1043861078 8:85317863-85317885 GTAGGAGGGTTGGGTAGGTGTGG - Intergenic
1044813045 8:96083332-96083354 TGATGGTGGGTGGGTAACTGGGG + Intergenic
1045182953 8:99805886-99805908 GAATGATGGTAGGGGAAGTAAGG + Intronic
1047823351 8:128546409-128546431 GGATGATAGGTGTGAAAGTGTGG + Intergenic
1048032529 8:130646178-130646200 TGATGCAGGTTGGGCAAGTGTGG - Intergenic
1050041145 9:1495307-1495329 ATGTGATGGTTGGGGAAGTGGGG + Intergenic
1050186345 9:2979105-2979127 GGATGGTGGATGGGTAAAGGGGG - Intergenic
1051693119 9:19738355-19738377 GGATGATGTTAGGGTAAAAGTGG + Intronic
1052830878 9:33214443-33214465 GGATGATGGATAGGTAACGGAGG + Intergenic
1052913086 9:33901864-33901886 GGATGATGGTTGTCAAGGTGAGG - Intronic
1053144264 9:35701690-35701712 TGATGATGGTTTGGACAGTGTGG + Intronic
1055509082 9:76977014-76977036 GGGTAATGGTTCGGTAATTGTGG + Intergenic
1055858717 9:80723514-80723536 GGAGGATTGTTGGGAAGGTGTGG - Intergenic
1056300712 9:85237702-85237724 GGATGGTGTCTGGGGAAGTGAGG - Intergenic
1057772271 9:97979165-97979187 GGATGCTGCTTGGGTAAGGAAGG + Intergenic
1060947276 9:127577417-127577439 GGAGGATGGTGTGGGAAGTGTGG - Intronic
1060947285 9:127577452-127577474 GGAGGATGGTGTGGGAAGTGTGG - Intronic
1060947294 9:127577487-127577509 GGAGGATGGTGTGGGAAGTGTGG - Intronic
1061256681 9:129457522-129457544 GGAAGATGGATTGGTGAGTGAGG + Intergenic
1062006518 9:134240975-134240997 GGGTGATGGGTGGTTAAGTTTGG - Intergenic
1186369357 X:8930627-8930649 GGACAATGATTGGGCAAGTGGGG + Intergenic
1187049865 X:15685201-15685223 GGAGAATGGTTAGATAAGTGAGG + Intergenic
1192366330 X:70476801-70476823 AAATGATTGTTGGGTAAATGAGG - Intronic
1192388750 X:70702255-70702277 GGATGATGGTTGCTGAAGTTGGG - Intronic
1192848353 X:74927916-74927938 GGATTTTGGTTGGGTAATTGGGG + Intergenic
1194424930 X:93725051-93725073 GGAAGAAGGTTGGGAAAATGTGG - Intergenic
1195848499 X:109255664-109255686 GGTTGAGGGTTGGGGATGTGTGG + Intergenic
1196002543 X:110802241-110802263 GGATGATGATAAGGTAACTGTGG + Intergenic
1197106393 X:122721516-122721538 TGATGATGGTTGAGGAGGTGGGG - Intergenic
1197461109 X:126742484-126742506 GGAGGCTGGTTAAGTAAGTGTGG - Intergenic
1197727146 X:129783837-129783859 GGATGCTGGCTGGGGCAGTGTGG + Intronic
1199011162 X:142760439-142760461 GGGTGTTGGTTGGCTAAGAGAGG - Intergenic
1199942980 X:152642339-152642361 GGAGGATGTGTGGGGAAGTGAGG - Intronic
1200002484 X:153069197-153069219 GGCAGATGGATGGGTACGTGCGG + Intergenic
1200005240 X:153080813-153080835 GGCAGATGGATGGGTACGTGCGG - Intergenic