ID: 999434302

View in Genome Browser
Species Human (GRCh38)
Location 5:151551191-151551213
Sequence CTATGGGTATAGGGGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999434302 Original CRISPR CTATGGGTATAGGGGGATGA TGG (reversed) Intronic
900120686 1:1047490-1047512 CTCTGGGTATCTGGGGAGGAAGG - Intronic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
902805357 1:18857962-18857984 ATATGGGTAGTGGGTGATGATGG - Intronic
903808210 1:26020445-26020467 GTATGGGGATAGAGGGATGAAGG + Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
910269421 1:85377705-85377727 GTATGGGGGTGGGGGGATGAGGG - Intronic
910705168 1:90121987-90122009 GTGTGTGTATAGTGGGATGATGG + Intergenic
911283405 1:95959370-95959392 CTGTGGGTTTACGGGAATGAGGG + Intergenic
912394867 1:109334525-109334547 CTTGGGGTATGGGGAGATGAAGG + Intronic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
915924564 1:160005941-160005963 GTAAGGGGAGAGGGGGATGAGGG - Intergenic
915959141 1:160249946-160249968 CTATAGGAATAGAGGGATCAGGG + Intronic
917537263 1:175883511-175883533 CTATGGGGCTAAAGGGATGAGGG - Intergenic
917680977 1:177367004-177367026 CTATGGATGGAGGGGGATCAAGG + Intergenic
918644639 1:186889363-186889385 CAATGGGTCTTCGGGGATGAAGG + Intronic
920039548 1:203086388-203086410 TGGTGGGTATAGGGGGAGGAGGG + Intergenic
921265226 1:213416323-213416345 CCATGGGGCTTGGGGGATGATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923500213 1:234558409-234558431 CTATGATTATTGGGTGATGATGG + Intergenic
924064484 1:240208169-240208191 CTCCGGGTAGAGGGGGAGGAGGG - Exonic
1066471120 10:35699240-35699262 CTATGTGTAAAGGGGCAAGAGGG + Intergenic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1070577843 10:77693232-77693254 ATAAGGGTATTGGGGGGTGAAGG - Intergenic
1070732867 10:78843408-78843430 CTATGGCAAGAGTGGGATGAAGG + Intergenic
1072873079 10:99141359-99141381 CTAAGGTTACAGGGAGATGATGG - Intronic
1073451949 10:103615243-103615265 CTATGGGGAGAGGGGGCTCATGG + Intronic
1073520431 10:104123051-104123073 CTATTTGTATAGGGAGATGATGG - Exonic
1074435424 10:113430201-113430223 ATATGGGTTGAGGGGGAGGAGGG + Intergenic
1076618161 10:131770641-131770663 CGATGGGGAAAGGGGGATGGGGG + Intergenic
1076798260 10:132809142-132809164 CAAGGGGTAGAGGGGGATGGTGG - Intronic
1077523210 11:3048618-3048640 CTCTGGGTGCTGGGGGATGAGGG + Intronic
1078306742 11:10195832-10195854 CTCTTGTTATAGGGGAATGAAGG + Intronic
1078851475 11:15167997-15168019 CTATGGGCAAAGGAAGATGAAGG - Intronic
1081215531 11:40392122-40392144 CTAGGGGTTTGTGGGGATGAGGG + Intronic
1085140876 11:74140250-74140272 CTATTGGAACAGAGGGATGAAGG - Intronic
1086801241 11:91178750-91178772 CTAAGTGTATATGGGGAGGAAGG + Intergenic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1088974567 11:114804225-114804247 CTATGGGAATAGGGAGCAGAGGG - Intergenic
1089004034 11:115075772-115075794 CTGTGGGTATAGGGTCAAGATGG + Intergenic
1089740232 11:120577351-120577373 CTATGGGAAGAGTGGGATGATGG + Intronic
1089870336 11:121666986-121667008 ATCAGGGTATAGTGGGATGATGG - Intergenic
1090037213 11:123259451-123259473 TTGTGGGTTTAGGGGAATGAGGG + Intergenic
1092656426 12:10689777-10689799 CTAAGAGTATAGGGTGATAATGG - Intergenic
1095628687 12:44348398-44348420 CTTGGGGTAAAGGGTGATGATGG - Intronic
1095679588 12:44958530-44958552 GTATGGGGAGAGGGGGACGACGG + Intergenic
1096746781 12:53733896-53733918 CTATGGGAATCGGGGGAAGCGGG + Intergenic
1098099706 12:67001748-67001770 CTATAGGTACAGTGGGATGCAGG - Intergenic
1098150008 12:67537197-67537219 CAATGGCTCAAGGGGGATGACGG - Intergenic
1100472488 12:94905835-94905857 TTGTGGGTTTAGGGGAATGAAGG + Intronic
1102721038 12:115016440-115016462 CTATGGGGATAGGAGGTTCATGG - Intergenic
1104482176 12:129117257-129117279 CTAGGGGTTCAGGGGGAGGAGGG + Intronic
1106207425 13:27613028-27613050 GTATGGGGGTAGGGGGTTGAGGG + Intronic
1109139420 13:58695761-58695783 CTAATGGTGGAGGGGGATGAGGG + Intergenic
1109447382 13:62459874-62459896 TTATGGGAAGAGGGGGATCAGGG - Intergenic
1111854529 13:93621108-93621130 CTATGGGTGCAGGGGAAAGAGGG + Intronic
1112017758 13:95345448-95345470 CTATGGGTACAGTGGCCTGAAGG + Intergenic
1114249314 14:20944375-20944397 CTAGGAATATTGGGGGATGAAGG + Intergenic
1115304455 14:31919413-31919435 CTCTGGCTGAAGGGGGATGAGGG - Intergenic
1115729482 14:36252980-36253002 CTATGGGTGGAAGGGGAAGAGGG + Intergenic
1116043456 14:39714318-39714340 CCATGGGGATAGAGGGATGTGGG + Intergenic
1118590060 14:67394545-67394567 CTATGGGTCTAGGTGGGTGCAGG - Intronic
1121102497 14:91259739-91259761 CCATGGGCATCGGGGGAAGAAGG - Intergenic
1121112574 14:91322220-91322242 CTGTGGGTACAGGGGGGTGATGG + Intronic
1122262633 14:100531900-100531922 CTGTGGGGAAAGGGGGCTGAGGG - Intergenic
1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG + Intergenic
1123049517 14:105534099-105534121 CTACCGTTCTAGGGGGATGAAGG - Intergenic
1127535583 15:59886931-59886953 GGATGGGTCAAGGGGGATGAGGG - Intergenic
1127856771 15:62960017-62960039 CTGTGGGGAGAGGGGGATGGGGG + Intergenic
1128453105 15:67818532-67818554 CCATGGACAGAGGGGGATGAGGG + Intergenic
1131842594 15:96453384-96453406 ATATAGGTATAGGGGTAGGATGG - Intergenic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133664565 16:7953724-7953746 GGATGGGTAGAGGGGGCTGAGGG + Intergenic
1136179821 16:28543453-28543475 CTCTGGAGATAGGGAGATGAAGG + Intergenic
1139138490 16:64233460-64233482 CTTTGGGTTTGGGGGGCTGAAGG + Intergenic
1139409768 16:66750315-66750337 CCATGGGAATTGGGGGATGGAGG + Intronic
1139528688 16:67531029-67531051 CTATGGGACTCGGGGGATGGTGG + Intronic
1139791192 16:69436876-69436898 CTATGGAAATAGGGGACTGATGG - Intronic
1140907859 16:79425073-79425095 CTTTGGGTATATGGGGAAAAAGG - Intergenic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1148763627 17:50022778-50022800 CTCTGGGAATGGGGGGTTGAGGG - Intergenic
1149013509 17:51882454-51882476 GTATGGGTGTTGGGGGAGGATGG + Intronic
1149132554 17:53322437-53322459 CTATGGATATTGGGGGCAGAAGG + Intergenic
1149308140 17:55369139-55369161 CTAAGTGAATAGGGAGATGAGGG - Intergenic
1150269139 17:63851221-63851243 CTATGGGGATAGTGGGGTGAGGG + Intergenic
1158024264 18:52877346-52877368 CTATTGGTCTAGAGGGAGGAGGG + Intronic
1161464975 19:4424303-4424325 CTCTGGGTAAAGGGGAAGGAGGG - Intronic
1161503820 19:4633221-4633243 CTAGGGGTAGAGAGGGAGGAGGG + Intergenic
1162823025 19:13234846-13234868 CTATGGGAACAGAAGGATGAAGG + Intronic
1167739016 19:51312684-51312706 CGATGGGCATGGGAGGATGAAGG + Intronic
932166173 2:69509351-69509373 CGTTGGGTTTTGGGGGATGAGGG + Exonic
933177387 2:79190915-79190937 CTATGGGTAGAGTGAGAAGATGG - Intronic
933192331 2:79348840-79348862 GAAAGGGTACAGGGGGATGAGGG - Intronic
935110753 2:100092268-100092290 TTCTGGGTAGAAGGGGATGAGGG - Intronic
935716742 2:105945925-105945947 GTGTGGGTGTAGGGGGATGGTGG + Intergenic
936124218 2:109772894-109772916 TTCTGGGTAGAAGGGGATGAGGG + Intergenic
936220470 2:110598570-110598592 TTCTGGGTAGAAGGGGATGAGGG - Intergenic
941239093 2:163014805-163014827 TTGTGGGTTTAGGGGAATGAGGG + Intergenic
942258371 2:174130344-174130366 CTATGCGTGTATGGGGGTGAGGG + Intronic
942509935 2:176687170-176687192 CTATGGGTAAAGGGGGCAGGAGG - Intergenic
944239815 2:197475496-197475518 CACTGGGTATAGAGTGATGAAGG + Intergenic
948513896 2:238490911-238490933 CTATGGGAATAGGGGTAAGGCGG - Intergenic
948856211 2:240731860-240731882 CTATGGGGATTGGGGGGTAAGGG + Intronic
1170315520 20:15036701-15036723 CTTTGGGTATAGAAAGATGATGG - Intronic
1174444592 20:50582198-50582220 TTATGGGGATGGGGTGATGAGGG - Intronic
1175027309 20:55915841-55915863 CTTTGGGTATTTGGGGAGGAAGG + Intergenic
1175852533 20:62101521-62101543 GTGTGGGTGTAGGGGGATGAGGG + Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1178156833 21:29863954-29863976 CTATTGGAACAGGAGGATGAAGG - Intronic
949516310 3:4810380-4810402 ATATAGGTATGGGAGGATGATGG - Intronic
950220439 3:11191403-11191425 CTATGGGAAGAGGGGGAGGTGGG - Intronic
954967647 3:54625431-54625453 CTATCTGTAAAGTGGGATGATGG + Intronic
957143608 3:76393911-76393933 ATAGGGATATAGGTGGATGAGGG + Intronic
958738889 3:98043786-98043808 TTATGGGTTTACGGGAATGAGGG - Intergenic
960337967 3:116441624-116441646 CTATGGGTATGAGGGTAGGAGGG + Intronic
962036929 3:131661961-131661983 CTATGGGTTTGGGGGAATTATGG + Intronic
962669303 3:137689118-137689140 CTCTGGGCTTAGGGGGATGAAGG + Intergenic
964645779 3:158957062-158957084 CTGTGGGTATAAGGGGATTCAGG - Intergenic
968424155 4:510416-510438 CTGTGGGTTTACGGGAATGAGGG - Intronic
970547259 4:17142449-17142471 CCATGGGTGTAGGTGGTTGAAGG + Intergenic
971474610 4:27060865-27060887 CTATGGGAAGAGTGAGATGAAGG + Intergenic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
973944777 4:55945275-55945297 CTTTTGGTATAGGGCCATGAAGG + Intergenic
974519198 4:62959196-62959218 CTATGGGTATAGGCTTGTGAAGG + Intergenic
975098350 4:70483549-70483571 ATATGAAAATAGGGGGATGAGGG - Intergenic
976128496 4:81858543-81858565 CTGTGGGTTTATGGGAATGACGG - Intronic
976179592 4:82386604-82386626 TTGTGGGTTTAGGGGAATGAGGG - Intergenic
976977336 4:91181056-91181078 CTGTGGGTTTATGGGAATGAGGG - Intronic
981332350 4:143526520-143526542 GTATGGGTATAGCTGGAAGAAGG + Intronic
982955708 4:161763528-161763550 CTATGGGTGTAGGGGAGAGAAGG + Intronic
983055913 4:163098734-163098756 CTATGTGTTTTGGGAGATGAGGG + Intergenic
984363424 4:178767631-178767653 TTATGGGTTTATGGGAATGAGGG + Intergenic
984964011 4:185125693-185125715 TTGTGGGTTTAGGGGAATGAGGG + Intergenic
985801337 5:2007022-2007044 CCGGGGGTCTAGGGGGATGATGG + Intergenic
992079883 5:73226181-73226203 CTAAAGGTGTGGGGGGATGAAGG - Intergenic
992087498 5:73291134-73291156 CTTTGGGAATAGTGGGATGCAGG + Intergenic
996000917 5:118362461-118362483 CTGTCGGTGTAGGGGGAGGAGGG + Intergenic
996480635 5:123971596-123971618 GTAAGGGGATAGGGGGATGTGGG + Intergenic
999434302 5:151551191-151551213 CTATGGGTATAGGGGGATGATGG - Intronic
1000637844 5:163664138-163664160 TTATAGATATAGGGGGATCACGG - Intergenic
1001525282 5:172424355-172424377 CTGTGGGTAGAGGGGAATGAGGG + Intronic
1002988351 6:2213741-2213763 CTATGAGAATAGGAGGACGAAGG + Intronic
1003860660 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG + Intergenic
1003902746 6:10670018-10670040 ATATGGCTAGAGGAGGATGATGG + Intergenic
1004297754 6:14429528-14429550 CTATGGGCATAGTGGGCTGGAGG - Intergenic
1006299602 6:33186517-33186539 TGATGGGAATAGGGAGATGAGGG + Intronic
1007755763 6:44098345-44098367 CCATGTGTATGGGGGAATGAGGG - Intergenic
1008696852 6:54048454-54048476 CAAAGGGTATTGGGGGTTGAGGG + Intronic
1009653818 6:66513306-66513328 CAAAGGGAATAGGGAGATGATGG + Intergenic
1009976678 6:70678458-70678480 CTTTTGGTGTAGGGTGATGATGG + Intronic
1010796020 6:80117580-80117602 TTGTGGGTTTACGGGGATGAGGG + Intronic
1015315837 6:131815096-131815118 ATTTGGGTATAGGGAGATGGAGG + Intronic
1016244430 6:141965965-141965987 CTATGGGAGTATGGTGATGAGGG - Intergenic
1017628369 6:156370976-156370998 CTATGGATACAGAGGGCTGATGG - Intergenic
1021092893 7:16503896-16503918 CTTTGGGTATTGGAGGTTGATGG - Intronic
1022283202 7:28931120-28931142 GTCGGGGGATAGGGGGATGAAGG - Intergenic
1022757386 7:33307830-33307852 CTATGAATATAGAGGGCTGATGG + Intronic
1022838065 7:34135861-34135883 ACTTGAGTATAGGGGGATGAGGG + Intronic
1025766896 7:64464167-64464189 TTATGGCTAAAGGGGGCTGAGGG - Intergenic
1028279248 7:88899758-88899780 ATATGGGTATCTGAGGATGATGG - Intronic
1029304868 7:99611700-99611722 CTCTGGCTATAGGGAAATGATGG - Intergenic
1031917740 7:127578914-127578936 CTGGGGGAAAAGGGGGATGAGGG + Intergenic
1032536308 7:132667564-132667586 CTATGGGTACAGGAGAAAGACGG + Intronic
1033029768 7:137814515-137814537 CTATGGGGAGTGGGGGATTAGGG - Intronic
1034464602 7:151219223-151219245 CTCAGAGTTTAGGGGGATGAGGG + Intronic
1034701741 7:153102441-153102463 CTAGGGAGATAGGGGGATAAAGG - Intergenic
1038493108 8:27983868-27983890 CCATGGGGATAGTGGGATCAGGG - Intronic
1039161204 8:34623427-34623449 ATATGGGTATAGGGGTCTAATGG - Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1042312933 8:67396603-67396625 CCATGGGACTAGGGGGATGGGGG - Intergenic
1045133825 8:99190274-99190296 TTAAGGGGATAGGGGCATGAAGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1048209567 8:132443547-132443569 GTGTGGGTAGTGGGGGATGATGG - Intronic
1048837185 8:138531164-138531186 CTATGATTATAGGGGTATGGGGG + Intergenic
1052112912 9:24611190-24611212 CTATAAATATATGGGGATGAAGG - Intergenic
1053181648 9:35976556-35976578 ATATGGGTATCAGGGGATGATGG + Intergenic
1056044265 9:82700800-82700822 CTATGAGTTTAGGGGGAAAAAGG - Intergenic
1059685230 9:116628811-116628833 CTATGTGTATATGGGGTAGAGGG + Intronic
1060824491 9:126680130-126680152 CCAGGGTTATGGGGGGATGATGG - Intronic
1186398933 X:9238789-9238811 TTTTGGGTAGAGGGGGAAGATGG + Intergenic
1186490581 X:9969237-9969259 TTAAGAGTATATGGGGATGAAGG - Intergenic
1188894125 X:35645552-35645574 TTGTGGGTTTAGGGGAATGAGGG - Intergenic
1190123047 X:47679306-47679328 AATTGGGTATAGAGGGATGAGGG + Intergenic
1190729165 X:53213568-53213590 CTATGGGTATAGGGGCAGTAAGG - Intronic
1191833359 X:65438803-65438825 TTGTGGGTTTATGGGGATGAGGG - Intronic
1194424426 X:93718969-93718991 CTATGGATTTTGGGTGATGATGG - Intergenic
1195432830 X:104808499-104808521 TTATGGGTTTAGGTGGATGGAGG + Intronic
1196881517 X:120202666-120202688 CTATTTGTATAGGGAGATGATGG + Intergenic
1197017195 X:121639486-121639508 CTATGGTTATAGGAAGATCACGG - Intergenic
1197645943 X:129016663-129016685 GTAGGGGTGGAGGGGGATGAGGG - Intergenic
1198222258 X:134613375-134613397 CTATGGGCAGAGGCGGAGGAAGG + Intronic
1200970300 Y:9145635-9145657 TTATGGGTTTATGGGAATGAGGG - Intergenic