ID: 999436380

View in Genome Browser
Species Human (GRCh38)
Location 5:151566689-151566711
Sequence GACCCTGATGCTGGTTTTAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 123}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999436380_999436388 2 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436388 5:151566714-151566736 TGGCTGCTAGGCGGGCCAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 111
999436380_999436386 0 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436386 5:151566712-151566734 AGTGGCTGCTAGGCGGGCCAAGG 0: 1
1: 0
2: 1
3: 14
4: 178
999436380_999436393 26 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436393 5:151566738-151566760 TGTTGATAGGGACACTCTCAAGG 0: 1
1: 0
2: 0
3: 8
4: 93
999436380_999436383 -10 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436383 5:151566702-151566724 CATCAGGGTCAGTGGCTGCTAGG 0: 1
1: 0
2: 1
3: 14
4: 240
999436380_999436389 3 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436389 5:151566715-151566737 GGCTGCTAGGCGGGCCAAGGGGG 0: 1
1: 0
2: 3
3: 20
4: 254
999436380_999436385 -6 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436385 5:151566706-151566728 AGGGTCAGTGGCTGCTAGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 219
999436380_999436384 -7 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436384 5:151566705-151566727 CAGGGTCAGTGGCTGCTAGGCGG 0: 1
1: 0
2: 1
3: 18
4: 233
999436380_999436391 14 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436391 5:151566726-151566748 GGGCCAAGGGGGTGTTGATAGGG 0: 1
1: 0
2: 1
3: 14
4: 192
999436380_999436387 1 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436387 5:151566713-151566735 GTGGCTGCTAGGCGGGCCAAGGG 0: 1
1: 0
2: 0
3: 5
4: 92
999436380_999436390 13 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436390 5:151566725-151566747 CGGGCCAAGGGGGTGTTGATAGG 0: 1
1: 0
2: 1
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999436380 Original CRISPR GACCCTGATGCTGGTTTTAA TGG (reversed) Exonic