ID: 999436380

View in Genome Browser
Species Human (GRCh38)
Location 5:151566689-151566711
Sequence GACCCTGATGCTGGTTTTAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 123}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999436380_999436393 26 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436393 5:151566738-151566760 TGTTGATAGGGACACTCTCAAGG 0: 1
1: 0
2: 0
3: 8
4: 93
999436380_999436386 0 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436386 5:151566712-151566734 AGTGGCTGCTAGGCGGGCCAAGG 0: 1
1: 0
2: 1
3: 14
4: 178
999436380_999436388 2 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436388 5:151566714-151566736 TGGCTGCTAGGCGGGCCAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 111
999436380_999436384 -7 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436384 5:151566705-151566727 CAGGGTCAGTGGCTGCTAGGCGG 0: 1
1: 0
2: 1
3: 18
4: 233
999436380_999436391 14 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436391 5:151566726-151566748 GGGCCAAGGGGGTGTTGATAGGG 0: 1
1: 0
2: 1
3: 14
4: 192
999436380_999436390 13 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436390 5:151566725-151566747 CGGGCCAAGGGGGTGTTGATAGG 0: 1
1: 0
2: 1
3: 5
4: 84
999436380_999436383 -10 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436383 5:151566702-151566724 CATCAGGGTCAGTGGCTGCTAGG 0: 1
1: 0
2: 1
3: 14
4: 240
999436380_999436387 1 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436387 5:151566713-151566735 GTGGCTGCTAGGCGGGCCAAGGG 0: 1
1: 0
2: 0
3: 5
4: 92
999436380_999436389 3 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436389 5:151566715-151566737 GGCTGCTAGGCGGGCCAAGGGGG 0: 1
1: 0
2: 3
3: 20
4: 254
999436380_999436385 -6 Left 999436380 5:151566689-151566711 CCATTAAAACCAGCATCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 999436385 5:151566706-151566728 AGGGTCAGTGGCTGCTAGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999436380 Original CRISPR GACCCTGATGCTGGTTTTAA TGG (reversed) Exonic
900278074 1:1845964-1845986 AACCCTGAAGCTCCTTTTAAAGG - Intronic
900718878 1:4162225-4162247 AACCCTGATCCTTGTTTGAAAGG - Intergenic
906334073 1:44913479-44913501 GGCCCTGTTGCCTGTTTTAATGG + Intronic
906489515 1:46257337-46257359 GACCCTGAAGGTAGTTTTAATGG - Intronic
908868024 1:68574375-68574397 CACCCTCTTGCTGGGTTTAATGG + Intergenic
910222980 1:84907604-84907626 CAGCCTGAGGCTGGATTTAAGGG + Intergenic
910481533 1:87663300-87663322 ATACCTGAGGCTGGTTTTAAAGG - Intergenic
911553796 1:99317424-99317446 GATGCTGATGCTGTATTTAATGG - Intergenic
913718071 1:121559327-121559349 GTCCCTGCTGCTGTCTTTAAGGG + Intergenic
915017086 1:152744307-152744329 GGCACTGCTGCTGGTTTTAATGG - Intronic
920004079 1:202820038-202820060 GATACTGATGCTGGTCTTTAGGG + Intergenic
922231265 1:223688841-223688863 GACCTTGTTGCTGGTTTTCCAGG - Intergenic
922400318 1:225247287-225247309 AACCCAGATGATGGTTTTGATGG + Intronic
922717126 1:227883549-227883571 GACTCTGATTCTTGATTTAATGG - Intergenic
1067559929 10:47298235-47298257 GACCCTCAGGCTGGCTTGAATGG + Intergenic
1068219291 10:54023169-54023191 GACCCTGATGCTGGAATAAATGG - Exonic
1069907143 10:71738621-71738643 GACCCTGATGCTGGCAGCAATGG + Intronic
1077617328 11:3686665-3686687 GATCGTGATGGTGGTTTTACAGG - Intronic
1077918737 11:6627376-6627398 GACCCTGATGCTGGAGCTAATGG - Exonic
1078258031 11:9676949-9676971 GGCCCAGATGCAGTTTTTAAGGG + Intronic
1079759479 11:24310667-24310689 GCCCCTGAGGCTGCTTTCAAGGG - Intergenic
1081673130 11:44952787-44952809 GACCCTGCTGCTAGTCTTTAGGG - Intergenic
1085715117 11:78865573-78865595 GTCACTGATGGTGGTTTTGAGGG + Intronic
1091742155 12:2967003-2967025 GACCCTGTTTCTCGTTTTTATGG + Intronic
1094235118 12:28155422-28155444 TACTTTGATGCTGTTTTTAAGGG + Intronic
1098190813 12:67946497-67946519 GATACTGATGCTGGTTTGCATGG - Intergenic
1101838431 12:108311084-108311106 GACCCTGATGGTGGAATTGAAGG - Intronic
1102725307 12:115059043-115059065 GACCATGGTTCTGGTTTTAAGGG - Intergenic
1105614865 13:22002518-22002540 GACACTGAAGCTGGTATTAACGG + Intergenic
1107116494 13:36752598-36752620 GTCCCTAATGCTGTTTTTAATGG + Intergenic
1110123709 13:71914381-71914403 GTCCGTGATGCTGATTTTAATGG + Intergenic
1110663814 13:78091911-78091933 CACCCTTAGGCTGGTTGTAAAGG - Intergenic
1113332355 13:109342099-109342121 TGCCATGAGGCTGGTTTTAAAGG + Intergenic
1113482840 13:110634360-110634382 GACCCTTATGCCTCTTTTAAAGG + Intronic
1114552700 14:23542656-23542678 GATCCTGATTCTGAATTTAAGGG - Intronic
1117071460 14:52060906-52060928 AACCCTGATGCTCGTATGAAAGG - Intronic
1118065762 14:62188645-62188667 AACCATGATGCTAATTTTAAGGG - Intergenic
1121826727 14:97016325-97016347 GAGCTTGATGCTGGGTTTACAGG + Intergenic
1124085305 15:26544312-26544334 GAGTCTGGGGCTGGTTTTAAGGG - Exonic
1125173526 15:36793833-36793855 GACACTGATGCTGGCCTTTAAGG - Intronic
1129800615 15:78411061-78411083 GACTCTGATGATGGTTTCATGGG - Intergenic
1135073738 16:19375353-19375375 GATCCAGATGCTGGTTTTACAGG - Intergenic
1135432549 16:22398446-22398468 TACCCTGATGCTTGATTTTAGGG + Intronic
1137583117 16:49646425-49646447 TACACTGATGCTAGTTTTACAGG - Intronic
1141436890 16:84004759-84004781 GAACCTGATTCTGATCTTAATGG - Intergenic
1142653924 17:1377210-1377232 GGCCCTAATCCTGATTTTAAGGG + Intronic
1143749229 17:9016244-9016266 AACTCTGATGCTGGTTCCAAAGG + Intergenic
1143826626 17:9614032-9614054 GGCCCTGGTGCTTTTTTTAAGGG + Intronic
1149178756 17:53907831-53907853 AAACCTGCTGCTGGTTTAAAAGG - Intergenic
1150337728 17:64342602-64342624 GTCCCTGGTGCTGGTTTTTTAGG + Intronic
1150807983 17:68334275-68334297 TTCCCTGATGCTGTTTTTCAAGG - Intronic
1159682014 18:71366777-71366799 GACTGTGATGTTGGTTTTGAGGG + Intergenic
1161636721 19:5393824-5393846 GTTCCTGATGAAGGTTTTAAAGG + Intergenic
1162956412 19:14101053-14101075 GACCCTTATCCTGCTGTTAATGG + Intronic
1168344867 19:55645239-55645261 GAGCCTGAGGCTGGTGTTCAGGG + Exonic
1168611854 19:57807238-57807260 GACTCTGATGATGGTTTCATGGG + Exonic
1168616972 19:57846050-57846072 GACTCTGATGATGGTTTCACGGG - Exonic
925335867 2:3098746-3098768 GGCCCTCATTCTTGTTTTAAAGG - Intergenic
928401414 2:30981270-30981292 GACAGTGATCCAGGTTTTAAAGG + Intronic
929626247 2:43410786-43410808 GACAGTGATGATGGTTTTATGGG + Intronic
930258514 2:49118611-49118633 GACCCACATCCTGGTTTTCAGGG - Intronic
932676179 2:73783472-73783494 GGCCCTGCTGCCGCTTTTAAGGG - Intergenic
933164844 2:79064702-79064724 GAGCCTGATGCTGAATTCAAAGG - Intergenic
933569550 2:83993443-83993465 GACCCTGATGCTGTGTTTCAGGG - Intergenic
934690904 2:96358390-96358412 GACCCCGAGGCTGGGATTAAGGG + Intronic
939289136 2:140170535-140170557 GAACCTGAAGCAGGTTTCAAGGG + Intergenic
939846290 2:147250232-147250254 GACCCAGATACTTCTTTTAAGGG - Intergenic
940989183 2:160080857-160080879 GACAATGATGCTGCTTTGAAAGG - Intergenic
944734408 2:202548949-202548971 GACTGTGATGATGGTTTTATGGG - Intronic
945177311 2:207055483-207055505 GACACAGATGCTGCTTATAAAGG + Intergenic
946169294 2:217885034-217885056 GACCTTGATGATGCTTTCAAAGG - Exonic
946483358 2:220077599-220077621 GACCCTGAAGATGGATTGAAAGG + Intergenic
949000654 2:241610925-241610947 CCCCCAGAAGCTGGTTTTAAGGG - Intronic
1170756024 20:19207947-19207969 GACCTTGAGGCAGCTTTTAATGG - Intergenic
1171105812 20:22431169-22431191 GAGGCAGATGCTGGCTTTAAGGG + Intergenic
1172816476 20:37691215-37691237 CACCCTGATTCTGGTTCTAGTGG - Intergenic
1172940660 20:38651784-38651806 GATCCTGCTGATGGTTTTGATGG + Intergenic
1173062343 20:39674674-39674696 GACCCTTATCCTGGCTTTGAAGG - Intergenic
1173846458 20:46191693-46191715 GAACCTGGGTCTGGTTTTAAAGG + Intronic
1174255249 20:49249621-49249643 GAGCCTCATGCTGGTTCTGATGG + Exonic
1174344315 20:49918631-49918653 CACCCTGATGTTAGGTTTAAAGG + Intergenic
1174679418 20:52391171-52391193 GGTCCTGCTTCTGGTTTTAATGG + Intergenic
1175405628 20:58724227-58724249 GACCCTGATGCTGGAATTGTCGG + Intergenic
1175457018 20:59123241-59123263 GGCCCAGATGTTGGGTTTAAGGG + Intergenic
1178389195 21:32184836-32184858 GACCCTGTGGCTGGTTGTGAGGG - Intergenic
1183241178 22:36659344-36659366 GACCCTGATGCTACTTCTCAGGG + Intronic
1183550462 22:38480112-38480134 GATTCTGATGCTGGTGTTTATGG + Intronic
1184308398 22:43624724-43624746 GACCCAGATGCTCCTTTTGAGGG - Intronic
949336900 3:2984704-2984726 GATCGTGATACTGTTTTTAATGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
960322774 3:116257029-116257051 GACCCTGAGAGTGGTTTTCATGG + Intronic
969103671 4:4788988-4789010 GACCCTGAGGCTGCTTTCACAGG - Intergenic
970592464 4:17571402-17571424 GACAGTGATGCTGGATTAAAGGG - Intergenic
972272600 4:37525654-37525676 GTGCCTGATGCTGAATTTAAGGG - Intronic
972314288 4:37911468-37911490 GAGCCTGATGCAGGATTTTAGGG + Intronic
973178021 4:47232101-47232123 GACCCTGATGCTATTTTGACAGG - Intronic
975545452 4:75556034-75556056 GAACCTGATGTTGCTTTAAAGGG - Intronic
978110252 4:104954824-104954846 TTCCAAGATGCTGGTTTTAAGGG + Intergenic
979206098 4:118040101-118040123 GACCATGAGGATGGTTTTAGCGG + Intronic
979832613 4:125319166-125319188 GACCCTGATGAAGGTGTCAATGG + Exonic
979832755 4:125320747-125320769 GACCCTGATGCAGACATTAATGG + Exonic
980564966 4:134527685-134527707 GGTTCTGCTGCTGGTTTTAATGG - Intergenic
983789115 4:171772704-171772726 GACCTTGTGGCTGGTGTTAAAGG + Intergenic
984686021 4:182668950-182668972 GACCCTATTGCTGCTATTAATGG - Intronic
986063983 5:4218013-4218035 GGGCCTGTTCCTGGTTTTAATGG + Intergenic
993015945 5:82534772-82534794 GACACTGATGCACATTTTAAAGG + Intergenic
995240775 5:109883883-109883905 GACCTTCATGCTGGTCTCAACGG - Exonic
996113728 5:119595546-119595568 GACACTGCTGTTGGCTTTAATGG + Intronic
998404921 5:141868870-141868892 GACCGTGATGCTGGTCCCAACGG - Exonic
999436380 5:151566689-151566711 GACCCTGATGCTGGTTTTAATGG - Exonic
999500811 5:152144757-152144779 GTCCCTGATGCGGGTTGTAAGGG - Intergenic
999717279 5:154371430-154371452 GACTCTGATGATGGTTCTACCGG - Intronic
1002957386 6:1879869-1879891 AACCCTGATACTGTATTTAAGGG + Intronic
1003684751 6:8291113-8291135 GATCATGATGCTGGTTTCATGGG - Intergenic
1003699697 6:8448127-8448149 CACCTTGATTCTGGTTTTATGGG - Intergenic
1006688889 6:35862287-35862309 GACCCTGATGGTGGCATTAGTGG - Intronic
1007236655 6:40395288-40395310 GACCCAGAAGCTAGTGTTAAAGG - Intronic
1010079949 6:71849357-71849379 GACACATAAGCTGGTTTTAAAGG + Intergenic
1014693328 6:124588769-124588791 GTCCCTGAGGCTTATTTTAAAGG - Intronic
1014811226 6:125888402-125888424 AACCCTGATTCTGGGTTTCATGG - Intronic
1015243502 6:131052234-131052256 GCCACTGATGTTGATTTTAATGG + Intronic
1020778117 7:12482082-12482104 GATAGTGATGATGGTTTTAAAGG + Intergenic
1022382531 7:29873782-29873804 GAACCTTATGCAGGTTTTGAAGG - Intronic
1026807673 7:73438087-73438109 CAGCCTGCTGCTGGTTTTCAGGG + Intergenic
1028214414 7:88114166-88114188 GATCCTGATGCAGGTTTTCAGGG - Intronic
1032143075 7:129351783-129351805 GTCCCTGATACTGTTTTTCAAGG + Intronic
1032999856 7:137492411-137492433 GACACAGATGCTGGGTTTAAGGG + Intronic
1034826128 7:154264868-154264890 GATCCTGATGATGGTGATAATGG + Intronic
1036599097 8:10242491-10242513 GACCCAGGTGGTGGTTGTAAGGG + Intronic
1036742813 8:11380417-11380439 GTGCCTGGTGCTGGTTTTAGGGG - Intergenic
1037234955 8:16708988-16709010 GACCTGGATACTGGTATTAAAGG - Intergenic
1186110658 X:6252403-6252425 GACCTTTCTGCTGGTTCTAATGG + Intergenic
1187490193 X:19744243-19744265 GCCTCTGATCCTTGTTTTAAGGG + Intronic
1189592063 X:42524073-42524095 TCCCCTGATGCTGCTTTTCATGG + Intergenic
1191922716 X:66274203-66274225 GTATCTTATGCTGGTTTTAAGGG - Intergenic
1193036703 X:76958610-76958632 GACACAGATGCTGGGTTAAAGGG - Intergenic
1193701145 X:84762471-84762493 AACCATGTTGCTGGCTTTAAAGG - Intergenic
1194261434 X:91700253-91700275 GACACAGATGCTGGGTTGAAGGG - Intergenic