ID: 999440278

View in Genome Browser
Species Human (GRCh38)
Location 5:151595472-151595494
Sequence AAGGAGGAGCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999440270_999440278 10 Left 999440270 5:151595439-151595461 CCACCTGGCTCTGCAGCCAGGGC No data
Right 999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG No data
999440271_999440278 7 Left 999440271 5:151595442-151595464 CCTGGCTCTGCAGCCAGGGCTGC No data
Right 999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG No data
999440273_999440278 -6 Left 999440273 5:151595455-151595477 CCAGGGCTGCTGCCGAAAAGGAG No data
Right 999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999440278 Original CRISPR AAGGAGGAGCAGAAGGTGGA AGG Intergenic
No off target data available for this crispr