ID: 999440520

View in Genome Browser
Species Human (GRCh38)
Location 5:151597247-151597269
Sequence GCCAAGCCCCTGAGTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999440520_999440534 26 Left 999440520 5:151597247-151597269 CCTTGCCCACTCAGGGGCTTGGC No data
Right 999440534 5:151597296-151597318 GAGCAGGGGCCCTCATGGGCGGG No data
999440520_999440529 12 Left 999440520 5:151597247-151597269 CCTTGCCCACTCAGGGGCTTGGC No data
Right 999440529 5:151597282-151597304 CCTCAAGGCCAGTAGAGCAGGGG No data
999440520_999440524 -3 Left 999440520 5:151597247-151597269 CCTTGCCCACTCAGGGGCTTGGC No data
Right 999440524 5:151597267-151597289 GGCTTCCACAGGTCACCTCAAGG No data
999440520_999440526 10 Left 999440520 5:151597247-151597269 CCTTGCCCACTCAGGGGCTTGGC No data
Right 999440526 5:151597280-151597302 CACCTCAAGGCCAGTAGAGCAGG No data
999440520_999440527 11 Left 999440520 5:151597247-151597269 CCTTGCCCACTCAGGGGCTTGGC No data
Right 999440527 5:151597281-151597303 ACCTCAAGGCCAGTAGAGCAGGG No data
999440520_999440531 21 Left 999440520 5:151597247-151597269 CCTTGCCCACTCAGGGGCTTGGC No data
Right 999440531 5:151597291-151597313 CAGTAGAGCAGGGGCCCTCATGG No data
999440520_999440533 25 Left 999440520 5:151597247-151597269 CCTTGCCCACTCAGGGGCTTGGC No data
Right 999440533 5:151597295-151597317 AGAGCAGGGGCCCTCATGGGCGG No data
999440520_999440532 22 Left 999440520 5:151597247-151597269 CCTTGCCCACTCAGGGGCTTGGC No data
Right 999440532 5:151597292-151597314 AGTAGAGCAGGGGCCCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999440520 Original CRISPR GCCAAGCCCCTGAGTGGGCA AGG (reversed) Intergenic
No off target data available for this crispr