ID: 999442110

View in Genome Browser
Species Human (GRCh38)
Location 5:151610082-151610104
Sequence CTGAGGAGGAGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999442099_999442110 23 Left 999442099 5:151610036-151610058 CCTGGTGAATGGGTCAGATTTTG No data
Right 999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999442110 Original CRISPR CTGAGGAGGAGGAAGGTGGA AGG Intergenic
No off target data available for this crispr