ID: 999442727

View in Genome Browser
Species Human (GRCh38)
Location 5:151615121-151615143
Sequence GGGCAGGCTGTACACCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999442727_999442739 20 Left 999442727 5:151615121-151615143 CCTTAGAGGTGTACAGCCTGCCC No data
Right 999442739 5:151615164-151615186 AGAGGCCTAGAAAGTAAGCTGGG No data
999442727_999442734 2 Left 999442727 5:151615121-151615143 CCTTAGAGGTGTACAGCCTGCCC No data
Right 999442734 5:151615146-151615168 GGAGGAAAGACCCCTGGCAGAGG No data
999442727_999442741 22 Left 999442727 5:151615121-151615143 CCTTAGAGGTGTACAGCCTGCCC No data
Right 999442741 5:151615166-151615188 AGGCCTAGAAAGTAAGCTGGGGG No data
999442727_999442731 -4 Left 999442727 5:151615121-151615143 CCTTAGAGGTGTACAGCCTGCCC No data
Right 999442731 5:151615140-151615162 GCCCTTGGAGGAAAGACCCCTGG No data
999442727_999442738 19 Left 999442727 5:151615121-151615143 CCTTAGAGGTGTACAGCCTGCCC No data
Right 999442738 5:151615163-151615185 CAGAGGCCTAGAAAGTAAGCTGG No data
999442727_999442740 21 Left 999442727 5:151615121-151615143 CCTTAGAGGTGTACAGCCTGCCC No data
Right 999442740 5:151615165-151615187 GAGGCCTAGAAAGTAAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999442727 Original CRISPR GGGCAGGCTGTACACCTCTA AGG (reversed) Intergenic
No off target data available for this crispr