ID: 999442875

View in Genome Browser
Species Human (GRCh38)
Location 5:151616053-151616075
Sequence GACACAGGTACTGTACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999442875_999442878 13 Left 999442875 5:151616053-151616075 CCTGTGTGTACAGTACCTGTGTC No data
Right 999442878 5:151616089-151616111 ATGCACATCGTTCTGCCTGAGGG No data
999442875_999442879 22 Left 999442875 5:151616053-151616075 CCTGTGTGTACAGTACCTGTGTC No data
Right 999442879 5:151616098-151616120 GTTCTGCCTGAGGGTCTGTATGG No data
999442875_999442877 12 Left 999442875 5:151616053-151616075 CCTGTGTGTACAGTACCTGTGTC No data
Right 999442877 5:151616088-151616110 CATGCACATCGTTCTGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999442875 Original CRISPR GACACAGGTACTGTACACAC AGG (reversed) Intergenic
No off target data available for this crispr