ID: 999442876

View in Genome Browser
Species Human (GRCh38)
Location 5:151616068-151616090
Sequence ATGTTCACTCACAGTGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999442876_999442879 7 Left 999442876 5:151616068-151616090 CCTGTGTCACTGTGAGTGAACAT No data
Right 999442879 5:151616098-151616120 GTTCTGCCTGAGGGTCTGTATGG No data
999442876_999442878 -2 Left 999442876 5:151616068-151616090 CCTGTGTCACTGTGAGTGAACAT No data
Right 999442878 5:151616089-151616111 ATGCACATCGTTCTGCCTGAGGG No data
999442876_999442877 -3 Left 999442876 5:151616068-151616090 CCTGTGTCACTGTGAGTGAACAT No data
Right 999442877 5:151616088-151616110 CATGCACATCGTTCTGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999442876 Original CRISPR ATGTTCACTCACAGTGACAC AGG (reversed) Intergenic
No off target data available for this crispr