ID: 999442877

View in Genome Browser
Species Human (GRCh38)
Location 5:151616088-151616110
Sequence CATGCACATCGTTCTGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999442875_999442877 12 Left 999442875 5:151616053-151616075 CCTGTGTGTACAGTACCTGTGTC No data
Right 999442877 5:151616088-151616110 CATGCACATCGTTCTGCCTGAGG No data
999442876_999442877 -3 Left 999442876 5:151616068-151616090 CCTGTGTCACTGTGAGTGAACAT No data
Right 999442877 5:151616088-151616110 CATGCACATCGTTCTGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999442877 Original CRISPR CATGCACATCGTTCTGCCTG AGG Intergenic
No off target data available for this crispr