ID: 999444671

View in Genome Browser
Species Human (GRCh38)
Location 5:151629798-151629820
Sequence GAGTAGGTAACTCATGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999444671_999444673 25 Left 999444671 5:151629798-151629820 CCTTTTGCATGAGTTACCTACTC No data
Right 999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG 0: 16
1: 101
2: 331
3: 1363
4: 7127
999444671_999444674 26 Left 999444671 5:151629798-151629820 CCTTTTGCATGAGTTACCTACTC No data
Right 999444674 5:151629847-151629869 AGAAGAAGAAGAAAGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999444671 Original CRISPR GAGTAGGTAACTCATGCAAA AGG (reversed) Intergenic
No off target data available for this crispr