ID: 999444672

View in Genome Browser
Species Human (GRCh38)
Location 5:151629814-151629836
Sequence ACTCTATTTATCATTTGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999444672_999444673 9 Left 999444672 5:151629814-151629836 CCTACTCAAATGATAAATAGAGT No data
Right 999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG 0: 16
1: 101
2: 331
3: 1363
4: 7127
999444672_999444676 18 Left 999444672 5:151629814-151629836 CCTACTCAAATGATAAATAGAGT No data
Right 999444676 5:151629855-151629877 AAGAAAGAAGAAGGGAGAGGAGG No data
999444672_999444674 10 Left 999444672 5:151629814-151629836 CCTACTCAAATGATAAATAGAGT No data
Right 999444674 5:151629847-151629869 AGAAGAAGAAGAAAGAAGAAGGG No data
999444672_999444677 30 Left 999444672 5:151629814-151629836 CCTACTCAAATGATAAATAGAGT No data
Right 999444677 5:151629867-151629889 GGGAGAGGAGGACCAGCCTGAGG No data
999444672_999444675 15 Left 999444672 5:151629814-151629836 CCTACTCAAATGATAAATAGAGT No data
Right 999444675 5:151629852-151629874 AAGAAGAAAGAAGAAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999444672 Original CRISPR ACTCTATTTATCATTTGAGT AGG (reversed) Intergenic
No off target data available for this crispr