ID: 999444673 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:151629846-151629868 |
| Sequence | AAGAAGAAGAAGAAAGAAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 8938 | |||
| Summary | {0: 16, 1: 101, 2: 331, 3: 1363, 4: 7127} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 999444671_999444673 | 25 | Left | 999444671 | 5:151629798-151629820 | CCTTTTGCATGAGTTACCTACTC | No data | ||
| Right | 999444673 | 5:151629846-151629868 | AAGAAGAAGAAGAAAGAAGAAGG | 0: 16 1: 101 2: 331 3: 1363 4: 7127 |
||||
| 999444672_999444673 | 9 | Left | 999444672 | 5:151629814-151629836 | CCTACTCAAATGATAAATAGAGT | No data | ||
| Right | 999444673 | 5:151629846-151629868 | AAGAAGAAGAAGAAAGAAGAAGG | 0: 16 1: 101 2: 331 3: 1363 4: 7127 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 999444673 | Original CRISPR | AAGAAGAAGAAGAAAGAAGA AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||