ID: 999444673

View in Genome Browser
Species Human (GRCh38)
Location 5:151629846-151629868
Sequence AAGAAGAAGAAGAAAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8938
Summary {0: 16, 1: 101, 2: 331, 3: 1363, 4: 7127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999444671_999444673 25 Left 999444671 5:151629798-151629820 CCTTTTGCATGAGTTACCTACTC No data
Right 999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG 0: 16
1: 101
2: 331
3: 1363
4: 7127
999444672_999444673 9 Left 999444672 5:151629814-151629836 CCTACTCAAATGATAAATAGAGT No data
Right 999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG 0: 16
1: 101
2: 331
3: 1363
4: 7127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999444673 Original CRISPR AAGAAGAAGAAGAAAGAAGA AGG Intergenic
Too many off-targets to display for this crispr