ID: 999446672

View in Genome Browser
Species Human (GRCh38)
Location 5:151645918-151645940
Sequence CTTTGACTAAGGAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999446669_999446672 -5 Left 999446669 5:151645900-151645922 CCTTTACAAGCAGATAGGCTTTG No data
Right 999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG No data
999446667_999446672 16 Left 999446667 5:151645879-151645901 CCGGAAAGGACTTTAGCTGAGCC No data
Right 999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999446672 Original CRISPR CTTTGACTAAGGAGAGAGGA AGG Intergenic
No off target data available for this crispr