ID: 999448396

View in Genome Browser
Species Human (GRCh38)
Location 5:151659647-151659669
Sequence CAGACCCCTCACATTTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999448395_999448396 0 Left 999448395 5:151659624-151659646 CCGTCTAGGCAGTGAGGAAAGAG No data
Right 999448396 5:151659647-151659669 CAGACCCCTCACATTTAAGTTGG No data
999448394_999448396 1 Left 999448394 5:151659623-151659645 CCCGTCTAGGCAGTGAGGAAAGA No data
Right 999448396 5:151659647-151659669 CAGACCCCTCACATTTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999448396 Original CRISPR CAGACCCCTCACATTTAAGT TGG Intergenic
No off target data available for this crispr