ID: 999450999

View in Genome Browser
Species Human (GRCh38)
Location 5:151678089-151678111
Sequence CTGAGATAGTTTGAGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999450999 Original CRISPR CTGAGATAGTTTGAGGTTGA AGG Intronic
901749761 1:11398688-11398710 CAGAGATACTTTGGGGTAGATGG - Intergenic
905992295 1:42348754-42348776 TTGAGGTGGTTTGAGGTTGTTGG - Intergenic
906537331 1:46558731-46558753 CTGAGATAGCTGGCGGTTAAGGG + Exonic
906857843 1:49327645-49327667 ATAAGACAGCTTGAGGTTGAAGG - Intronic
910487783 1:87734364-87734386 CTGAAACAGTTTTAGGCTGATGG + Intergenic
910770575 1:90827150-90827172 CTGTGAAAGTTGGAGTTTGAGGG + Intergenic
911068938 1:93816856-93816878 CTAAGATAGTTTTAGTTTGGGGG - Intronic
911998870 1:104804272-104804294 CTGAGATAGCTTCAGGCTTATGG - Intergenic
913547707 1:119885890-119885912 CTGAGATAATTTTAGTTTAATGG + Intergenic
914921006 1:151847452-151847474 CTGAGATGGCTGGAGCTTGATGG + Intronic
915202803 1:154245248-154245270 CCCAGATAGTTTCAGGATGAGGG - Intronic
915576462 1:156781871-156781893 CTGAGATTGGGTGAGGTTGTGGG + Intronic
916266006 1:162890421-162890443 CGGTGATAGTTTGAGTTTGTCGG + Intergenic
916349053 1:163828129-163828151 CTGAGATTCTCTGAGGTTTAGGG + Intergenic
918108149 1:181430822-181430844 CTGGGATAGTTGGATGTAGAGGG + Intronic
918175833 1:182044517-182044539 CTAAGTTATTTGGAGGTTGAGGG + Intergenic
918399995 1:184153720-184153742 GGGAGATAGTTTGGGGGTGACGG + Intergenic
918459714 1:184764052-184764074 CTGACATAGTTGGGGGATGAAGG - Intergenic
919362873 1:196617104-196617126 CTTAGATAGTTTCAGGATGAGGG + Intergenic
921935614 1:220793730-220793752 TTGAGATGGTTTGAGGTTTGAGG - Intronic
924827983 1:247562113-247562135 CTGAGATACCTTGAAGCTGAGGG + Intronic
1068547834 10:58371142-58371164 TTGAGATAGTTGGAGGATGGTGG - Intergenic
1070170246 10:73927393-73927415 CAGAGAAAGTTTGAGGCTGGGGG - Intergenic
1071492039 10:86142842-86142864 TTGAGATGGTTTTAGGTAGAGGG - Intronic
1074212421 10:111348787-111348809 CAGAGATTGTTTGAGATTGGTGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1079335802 11:19569540-19569562 CTGCCATAGTTTGAGGCAGAAGG - Intronic
1080157114 11:29124524-29124546 CTGAAATAATTTGAGGCTGTAGG + Intergenic
1080395300 11:31884627-31884649 CTGAGATATTTGTGGGTTGAGGG - Intronic
1081403677 11:42671208-42671230 CTGAGTTAGTTTGAGGATAATGG - Intergenic
1081580492 11:44348496-44348518 CTGAGCAAGTTAGAGGCTGAGGG - Intergenic
1090960735 11:131554320-131554342 CTGTGATGGTTTGAGGCTTAAGG + Intronic
1092965032 12:13633182-13633204 CTGATATAGAATGAGGTTGAGGG + Intronic
1094145545 12:27225149-27225171 CTGAGACAGTTAGAGAGTGATGG + Intergenic
1096721141 12:53523064-53523086 CTGTTATAGTTGGGGGTTGAAGG - Intronic
1098044140 12:66382604-66382626 CTGAGATCTTGAGAGGTTGAAGG - Intronic
1100002884 12:89858542-89858564 CTGAGTTAGGTGGAGGTTGTAGG + Intergenic
1101637431 12:106556749-106556771 CTGAGATGGTTTTAGCCTGATGG + Intronic
1105257751 13:18755672-18755694 CTGTGAAACTTTGAAGTTGAGGG - Intergenic
1105259932 13:18771513-18771535 CTGTGAAACTTTGAAGTTGAGGG - Intergenic
1105262612 13:18790836-18790858 CTGTGAAACTTTGAAGTTGAGGG - Intergenic
1106571817 13:30934354-30934376 CCGAAATAGGATGAGGTTGATGG + Intronic
1111358315 13:87140563-87140585 CTGAGAAAGTGTGGGGTTGGGGG - Intergenic
1111845082 13:93497633-93497655 TTGATATAGTTTGAAGCTGAAGG + Intronic
1113555603 13:111231643-111231665 CTTAGAGTGTTTGGGGTTGAAGG + Intronic
1115387385 14:32813475-32813497 CTGAGATAGCCTCAGGTTGGGGG - Intronic
1117909189 14:60620044-60620066 CTGAGATAGGGTGATGATGAGGG + Intergenic
1121217739 14:92261689-92261711 CTGAGAAAGTTCAAGGTGGAAGG - Intergenic
1124188995 15:27555028-27555050 CTGAGAAAGGTTGAGGCTAAGGG - Intergenic
1125051889 15:35308673-35308695 CTGAGATAGTTTGTATTTTAAGG + Intronic
1125998734 15:44189370-44189392 CTGAGACAGTTTTAGCCTGATGG + Intronic
1127206847 15:56730552-56730574 CTGAAGTAGTTTGATGTTGGAGG - Intronic
1127950498 15:63800846-63800868 CTTAGATAGCTTCAGGATGAAGG + Intronic
1129150688 15:73685782-73685804 GTGGGACAGTTTGAGGCTGAGGG + Intronic
1130152251 15:81320020-81320042 CTGAGATTGAGTGAGGTTCAAGG - Intronic
1130678287 15:85973756-85973778 TTGAGCTAGCTTGAGGTTCAAGG - Intergenic
1130939926 15:88498822-88498844 CTGAGAGACTTTGAGGAAGAGGG - Intergenic
1130955666 15:88625777-88625799 CAGCCATGGTTTGAGGTTGAGGG + Intronic
1133852703 16:9520940-9520962 CTGACATAGTTATAGGTTAATGG - Intergenic
1134109927 16:11508856-11508878 CTGAGATGGTAAGAGGTGGATGG + Intronic
1137836919 16:51601210-51601232 CTTAGATAGCTTTAGGTTGAGGG + Intergenic
1138054382 16:53816593-53816615 ATGAGAGAGTTCCAGGTTGAGGG - Intronic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140533136 16:75684111-75684133 CTGAGATGGGTTGAGAGTGAGGG + Intronic
1146080540 17:29776363-29776385 CTGAAATAGTTTGGGATTGTTGG - Intronic
1146306340 17:31732644-31732666 CTGAGGTAGGTGGAGGCTGAGGG - Intergenic
1148093503 17:45036698-45036720 GTGTGATAGTCTGAGGTTGGAGG - Intronic
1148820808 17:50358511-50358533 GAGAGGTAGTTTGCGGTTGAAGG - Exonic
1150887802 17:69108003-69108025 GTGAGACAGTTTGAGGATGGAGG - Intronic
1155159593 18:23184945-23184967 CTGTGATAGTATGAGGTGGTGGG - Intronic
1155989027 18:32260200-32260222 TAGAGCTAGTTTCAGGTTGAGGG + Intronic
1158162647 18:54502695-54502717 CTGGGCTAGTTTAATGTTGAAGG + Intergenic
1160190919 18:76713416-76713438 CTGAGGGAGTGTGAGGTTGTGGG + Intergenic
1160408000 18:78656012-78656034 TGGAGATGGTTTGAGCTTGATGG - Intergenic
1163827301 19:19530761-19530783 CTGACATAGGATGAAGTTGAAGG - Intronic
1164773448 19:30831335-30831357 CTGAGCTACTTTAAGTTTGATGG - Intergenic
1165642011 19:37397741-37397763 ATAAGAGGGTTTGAGGTTGAAGG - Intergenic
1167373473 19:49098669-49098691 CGGAGAGAGTTTGAGGTGTACGG + Exonic
926979473 2:18552660-18552682 CTGAGAAGGGTTGAGGTTGCTGG - Intergenic
927064586 2:19458741-19458763 CTGAGATGGATTCAGGTAGAGGG + Intergenic
927269978 2:21196529-21196551 CTGAGAAAGTTTTAGGCAGAAGG - Intergenic
929395042 2:41513120-41513142 ATGATCTAGTTTGTGGTTGAAGG - Intergenic
930201251 2:48553817-48553839 CGTAGATTGTTTGAGTTTGAAGG + Intronic
931244253 2:60479431-60479453 CTGAGAGAGCTTGACGTTGGTGG - Intronic
933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG + Intergenic
933665824 2:84964122-84964144 CTGGTAGAGTTTGAGGATGAGGG + Intergenic
935656427 2:105427678-105427700 ATGAGAGTGTTTGAGGTTGCAGG + Intronic
935877747 2:107529732-107529754 ATGAGATAGTCTGAGTTTGTGGG + Intergenic
936388406 2:112051425-112051447 CTGAGGAAGTTAGAGGTTAAAGG - Intergenic
938857435 2:135328331-135328353 TTGTGATAGTTTGAGAATGATGG + Intronic
939459918 2:142486572-142486594 CTGAGATAGTTTTAGGAAGGGGG + Intergenic
939471223 2:142623396-142623418 TATAGATAGTTTGAGGTTAAAGG - Intergenic
943410543 2:187541470-187541492 GTGAGGCAGTTTGAGTTTGAAGG + Intronic
948362099 2:237429351-237429373 CTCAGGAAGTTTGTGGTTGAGGG - Intergenic
1169995549 20:11552272-11552294 CTGAGATTGTTGGCTGTTGATGG - Intergenic
1170777184 20:19386212-19386234 CTCAGATAGTTTGTTGTTAATGG + Intronic
1174920910 20:54701061-54701083 CTGACACAGCTTGTGGTTGATGG - Intergenic
1176000302 20:62828656-62828678 CAGACACAGTTTTAGGTTGATGG + Intronic
1182855750 22:33516301-33516323 CTGAAATAGTGTGAGGATGTGGG + Intronic
1185237389 22:49722392-49722414 GTGAGAAAGTTTTAGGTTGAAGG - Intergenic
949171095 3:998212-998234 CTGAGATAGCTTCAGGATGGGGG + Intergenic
949874809 3:8619224-8619246 CTCAGATATTTGGTGGTTGATGG - Intergenic
950104383 3:10378960-10378982 TTGAGATCCTTAGAGGTTGAGGG - Intronic
950477108 3:13221425-13221447 CTGAGGATGCTTGAGGTTGAAGG - Intergenic
951422592 3:22504953-22504975 CTAAGATCCTTTGAGTTTGAAGG + Intergenic
951811404 3:26704641-26704663 ATGAGATAGATTGAGGTGCAAGG - Intronic
952555856 3:34529869-34529891 CTAAGATAATTTGCGGTTCATGG + Intergenic
952574863 3:34762441-34762463 CTGAGAGTGTTTAAGGTTAAAGG - Intergenic
956145621 3:66188237-66188259 CAGAGAAAGTTTGGGGTTGCAGG - Intronic
958704569 3:97638635-97638657 CTGATATAATTTGTGGATGACGG - Intronic
959985899 3:112570982-112571004 CTGAGATAATTAGAGGTTAGTGG - Intronic
960742135 3:120846088-120846110 CTGAGATAGTTTGGGGTTCAAGG + Intergenic
963209201 3:142670078-142670100 CTGTGAGAGTTTGTGGTAGAAGG + Intronic
963860608 3:150306041-150306063 CTGAGATAGTAAGCAGTTGATGG + Intergenic
964800730 3:160554574-160554596 CCTAGATAGTTTCAGGATGAGGG + Intronic
964967039 3:162507799-162507821 TTGAGATAATTTGAGGCTTATGG - Intergenic
965843968 3:172939816-172939838 CTTAGATAGCTTCAGGATGAGGG + Intronic
967136015 3:186513173-186513195 CTGAGATCGTTTGAAGGAGATGG - Intergenic
970098548 4:12493093-12493115 ATGAGATAGATTGGGGTAGATGG - Intergenic
981976312 4:150733353-150733375 CTGAAGTATTTTGAGGTAGAAGG + Intronic
983290507 4:165798327-165798349 CTGAGATAGTTTATGGTTTTTGG - Intergenic
983361035 4:166723539-166723561 CTGAGATAGCTAGAACTTGAAGG + Intergenic
983532215 4:168822522-168822544 ATGAGTTAGTATCAGGTTGAAGG - Intronic
983953959 4:173675440-173675462 CTCAGATAATTTGAGGATGTAGG + Intergenic
987137933 5:14917205-14917227 CTGAGAAAGGTTGTGGGTGATGG + Intergenic
987398342 5:17447234-17447256 CTGAGATATTTGGAGTTTGATGG + Intergenic
989682949 5:44050983-44051005 CTGAGATAGATTGTGGTTTGGGG - Intergenic
993540261 5:89140704-89140726 CTGAGACTATTTGAGGTTGTAGG + Intergenic
993740548 5:91533308-91533330 CTCAGGTAGTTTCAGGTTGCTGG + Intergenic
994048036 5:95331143-95331165 GTGATGTAGTTTGAGGATGAAGG + Intergenic
994356885 5:98802751-98802773 CTGAGATATTTTGAAGTAAAAGG + Intergenic
995062655 5:107828014-107828036 CTGAGACAGTCTCAGGTAGAAGG - Intergenic
995192323 5:109330755-109330777 TTGAGATAGTTATAGGTTGAAGG - Intergenic
995614974 5:113951658-113951680 GTGAGAGAGTTTCAGGTAGAGGG + Intergenic
998624915 5:143835497-143835519 CTCAGAGAGGTTGAGATTGATGG + Intergenic
999450999 5:151678089-151678111 CTGAGATAGTTTGAGGTTGAAGG + Intronic
1000826904 5:166056109-166056131 CCAAAATAGCTTGAGGTTGATGG - Intergenic
1001203131 5:169737538-169737560 CTTAGGTAGTTTCAGGATGAGGG + Intronic
1003817523 6:9858811-9858833 AAGAGAAAGTTTGAGGTGGAAGG + Intronic
1004051099 6:12080232-12080254 CTGAAATAGTGTGAGGTTTTCGG + Intronic
1005508078 6:26487613-26487635 TAGAGATAGGTTGTGGTTGAAGG - Intergenic
1008903340 6:56648242-56648264 CCGAGATGGCTTGAGGTAGAAGG - Intronic
1009486567 6:64231168-64231190 CTAAGATTGTTTGAACTTGAAGG + Intronic
1009889918 6:69668318-69668340 TTAAGGTAGTTTGAGCTTGATGG - Intergenic
1011553293 6:88549157-88549179 CTTAGATATTGTGAGATTGAAGG - Intergenic
1013468506 6:110439112-110439134 CTGAGACAGTTTGGGGCTGGTGG - Intronic
1013578912 6:111512585-111512607 CAAAGACAGTTTGAGGGTGATGG + Intergenic
1014326112 6:119996046-119996068 CTGAGATTGTTTGATGTTAATGG + Intergenic
1014675336 6:124357567-124357589 ATCAGTTAGTTTGAGGCTGAGGG + Intronic
1020454756 7:8359319-8359341 CCTAGATAGTTTCAGGATGAGGG + Intergenic
1021559754 7:21958043-21958065 ATGAGATAGTGTGATGTTGGTGG - Intergenic
1021795413 7:24249429-24249451 ATGAGATAATTTGACATTGAGGG + Intergenic
1022611475 7:31878644-31878666 CTGGGATGCTTTGAGGTTGCTGG - Intronic
1023637270 7:42225069-42225091 CTGAGATTGTTAGAGCTAGAAGG - Intronic
1025121268 7:56305976-56305998 CTGAGAAACTTTGAGGCTGGAGG - Intergenic
1027532079 7:79347831-79347853 CTGGGATAGTTTAAGGTTTATGG - Intronic
1033468985 7:141626435-141626457 CTGAGATACTTTGAGACTGTGGG - Intronic
1036223077 8:6937133-6937155 CTGTGCTAGGTTGAAGTTGATGG + Intronic
1036964389 8:13279841-13279863 CTGGGATAGTTTGAAGTTTGTGG - Intronic
1037359622 8:18059503-18059525 CTGATATACTTTGAGTTTTAAGG - Intronic
1037636316 8:20703843-20703865 CTGAGATATCAGGAGGTTGATGG - Intergenic
1038405707 8:27320909-27320931 CTTAGATAGCTTCAGGATGAGGG - Intronic
1041821000 8:62032856-62032878 ATGAGATGGATTGTGGTTGAGGG + Intergenic
1042712320 8:71732246-71732268 GTGAGATATTTTCAGTTTGAGGG - Intergenic
1043364778 8:79520362-79520384 CTCAGGTAGTTTGAGGTGGCAGG - Intergenic
1044379158 8:91512988-91513010 CTGAGATTTTTTTAGCTTGAAGG + Intergenic
1045551510 8:103176935-103176957 CTGAGTTAGTTTGAGCTGGTGGG + Intronic
1046587664 8:116167665-116167687 CTGAGATAGCTTTAAGATGAAGG + Intergenic
1046596224 8:116264384-116264406 CTTTGGTAGTTTGAGGGTGAGGG - Intergenic
1047288503 8:123508503-123508525 CTGAGATTGTTGGAGCTGGAAGG - Intronic
1047464918 8:125103473-125103495 CTGATATTGTTTGAGATTTATGG + Intronic
1047967284 8:130055601-130055623 CTGTGAAAGTTTGAGACTGATGG + Intronic
1048253057 8:132883117-132883139 CTCAGACAGGTTGAGCTTGAAGG - Intronic
1049965867 9:779155-779177 CTGAAATAGTTTGAGGAGAATGG - Intergenic
1050317278 9:4415287-4415309 CTGAGATAGTGAGAGAATGAAGG - Intergenic
1055324755 9:75117886-75117908 ATGAGCTATTTTGAGGTAGAGGG - Intronic
1057833008 9:98420844-98420866 CAGAAATAGTTCTAGGTTGAAGG + Intronic
1059691978 9:116694119-116694141 CTGAGATAATTTGGGGATGTGGG + Intronic
1186020374 X:5247718-5247740 CTGAGATAGTTTCAGGTAATTGG - Intergenic
1186899109 X:14033863-14033885 CTGAGTAAGTTTGATGCTGATGG - Intergenic
1186907174 X:14123703-14123725 CAGAGATAGTGGGAGGGTGAGGG - Intergenic
1187686510 X:21820845-21820867 CCAAGATAGTTTGAGATTTATGG + Intergenic
1188474979 X:30582087-30582109 CTGAGATAGTTGAAGTCTGATGG - Intergenic
1190439877 X:50466862-50466884 CTGATATGGTTTGAGGATAATGG + Intronic
1190786477 X:53655557-53655579 TTGAGATATTTTGAGGTTGTTGG - Intronic
1194090405 X:89577651-89577673 CTTTGATATTTTGAGCTTGATGG + Intergenic
1196411241 X:115421791-115421813 CTGAGCTAGAATGAGGTAGATGG - Intergenic
1196990930 X:121327933-121327955 TTGAGAGAATGTGAGGTTGAAGG + Intergenic
1197133243 X:123030499-123030521 CAGAGATAGATTGAAGTAGAGGG - Intergenic
1198070874 X:133147359-133147381 CTGAGAGACTTAGTGGTTGAAGG - Intergenic