ID: 999451162

View in Genome Browser
Species Human (GRCh38)
Location 5:151679338-151679360
Sequence TGAGTGAGTGACTGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1698
Summary {0: 1, 1: 0, 2: 11, 3: 211, 4: 1475}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999451155_999451162 22 Left 999451155 5:151679293-151679315 CCAAGGCCTAGAGGAAAGGAGAA 0: 1
1: 0
2: 2
3: 44
4: 420
Right 999451162 5:151679338-151679360 TGAGTGAGTGACTGGGTGGCAGG 0: 1
1: 0
2: 11
3: 211
4: 1475
999451158_999451162 -6 Left 999451158 5:151679321-151679343 CCAACGGCTAACAGCAGTGAGTG 0: 1
1: 0
2: 1
3: 6
4: 88
Right 999451162 5:151679338-151679360 TGAGTGAGTGACTGGGTGGCAGG 0: 1
1: 0
2: 11
3: 211
4: 1475
999451156_999451162 16 Left 999451156 5:151679299-151679321 CCTAGAGGAAAGGAGAAAACTGC 0: 1
1: 1
2: 2
3: 32
4: 420
Right 999451162 5:151679338-151679360 TGAGTGAGTGACTGGGTGGCAGG 0: 1
1: 0
2: 11
3: 211
4: 1475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999451162 Original CRISPR TGAGTGAGTGACTGGGTGGC AGG Intronic
900339925 1:2183416-2183438 TGAGTGAGTGAATGAGTGAATGG + Intronic
900497921 1:2984748-2984770 TGAGTGATTAACTTGATGGCTGG - Intergenic
900509331 1:3051165-3051187 TGGATGAGTGGATGGGTGGCTGG - Intergenic
900509367 1:3051279-3051301 TGAGTGGGTGAATGGATGGGTGG - Intergenic
900509370 1:3051287-3051309 TGAGTGTGTGAGTGGGTGAATGG - Intergenic
900535662 1:3175947-3175969 TGAGTGAGTGGATGGATGGATGG - Intronic
900535663 1:3175951-3175973 TGGGTGAGTGAGTGGATGGATGG - Intronic
900573479 1:3371496-3371518 TGGGTGGGTGAGTGGGTGGATGG - Intronic
900573497 1:3371555-3371577 TGGGTGAGTGGGTGGGTGGATGG - Intronic
900636744 1:3669667-3669689 TGCGTGAGTGCCGGGGAGGCCGG - Intronic
900649820 1:3725369-3725391 TGAGTGGGTGGATGGGTGGATGG + Intronic
900661299 1:3785375-3785397 AAAGTGAGTGCCTGGCTGGCCGG - Intronic
900703973 1:4065059-4065081 TGAGTGAATGAGTGAGTGGATGG - Intergenic
900739728 1:4323325-4323347 TGAAGGAATCACTGGGTGGCAGG - Intergenic
900747800 1:4373103-4373125 TGAGTGAGTGGATGGATGGATGG - Intergenic
900747801 1:4373107-4373129 TGGGTGAGTGAGTGGATGGATGG - Intergenic
900792148 1:4687803-4687825 TGAATGAGTGAATGGATGGATGG - Intronic
900929997 1:5730406-5730428 TGAGTGAGTCTCTGGCCGGCAGG - Intergenic
900941883 1:5804178-5804200 TGAGTGAATGGTTGGGTGGGTGG - Intergenic
900978821 1:6034799-6034821 TGAGTGAATGAATGAGTGGATGG - Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901245699 1:7728952-7728974 TGAGTGAGACACTTAGTGGCAGG + Intronic
901262506 1:7884693-7884715 TGAGTGAGTGTGTGGTTGGATGG - Intergenic
901270057 1:7945336-7945358 TGCGTCTGTGACTGGGTGTCTGG + Intergenic
901318013 1:8322028-8322050 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
901318014 1:8322032-8322054 TGAGTGGGTGGGTGGGTGGATGG + Intronic
901525573 1:9820653-9820675 TGAATGAATGAATGGGTGGATGG - Intronic
901858916 1:12062221-12062243 TGAGTGGGTAAATGGGTGGGTGG - Intergenic
901858939 1:12062324-12062346 TGAGTGGGTAAATGGGTGGGTGG - Intergenic
901859003 1:12062615-12062637 TGAGTGGGTAAATGGGTGGGTGG - Intergenic
901863710 1:12090358-12090380 TGAGTGAGTAGATGGGTGGATGG - Intronic
901863763 1:12090576-12090598 TGAGTGGGTGGGTGGGTGGATGG - Intronic
901863775 1:12090612-12090634 TGAATGAATGAGTGGGTGGATGG - Intronic
901928778 1:12583686-12583708 TGAGTGGATGAATGGGTGGATGG - Intronic
902202625 1:14845196-14845218 TGGGTGAGTGAGTGGATGGGTGG + Intronic
902202627 1:14845200-14845222 TGAGTGAGTGGATGGGTGGGTGG + Intronic
902248594 1:15138407-15138429 TGAGTGAGGGATTGGGTTGTTGG - Intergenic
902264211 1:15249771-15249793 AGAGAGAGTGACTGAGTGGGGGG - Intronic
902546021 1:17190810-17190832 TGAGGAAGGGACTGGGTGTCAGG - Intergenic
902935327 1:19760864-19760886 TGAATGAATGACTGAGTGGCTGG + Intronic
902949940 1:19874347-19874369 TGAGGGAGGGACCGGGTGGGAGG + Intergenic
903005544 1:20295738-20295760 TGAGGGAGTGGCTGGAGGGCAGG + Intronic
903181035 1:21604954-21604976 TGAGTGGGTGGGTGGGTGGATGG + Intronic
903213401 1:21830726-21830748 TGGGGGAGTGCCTGGGTGGCGGG + Intronic
903277480 1:22231242-22231264 TGGGTGTGTGAGTGGGTGGATGG - Intergenic
903277518 1:22231431-22231453 TGGGTGAATGAATGGGTGGATGG - Intergenic
903287129 1:22284347-22284369 TGAGTGGGTGGATGGCTGGCTGG - Intergenic
903287130 1:22284351-22284373 TGGGTGAGTGGGTGGATGGCTGG - Intergenic
903294285 1:22333781-22333803 TGAGTGATTGAGTGGATGGATGG + Intergenic
903294304 1:22333875-22333897 TGAGTGATTGAGTGGATGGATGG + Intergenic
903294687 1:22336234-22336256 TGAGTGATTGAGTGGATGGATGG - Intergenic
903294696 1:22336305-22336327 TGAGTGATTGAGTGGATGGATGG - Intergenic
903294736 1:22336561-22336583 TGAGTGATTGAGTGGATGGATGG - Intergenic
903294766 1:22336717-22336739 TGAGTGATTGAGTGGATGGATGG - Intergenic
903294787 1:22336861-22336883 TGAGTGATTGAGTGGATGGATGG - Intergenic
903294845 1:22337177-22337199 TGAGTGATTGAGTGGATGGATGG - Intergenic
903294894 1:22337464-22337486 TGAGTGATTGAGTGGATGGATGG - Intergenic
903294895 1:22337468-22337490 TGAATGAGTGATTGAGTGGATGG - Intergenic
903654746 1:24942450-24942472 AGAGAGAGTGACTGGGTGGATGG + Intronic
903666667 1:25012161-25012183 TGAGTGTGGGAGTGGGGGGCGGG - Intergenic
903690964 1:25173306-25173328 TGAATGAATGAATGGGTGGGTGG + Intergenic
904263112 1:29302460-29302482 TGGGTGAGTCACTGAGTGACTGG - Intronic
904311552 1:29632696-29632718 GGACTGAGTGGCTGGGAGGCTGG - Intergenic
904368751 1:30035168-30035190 TGAGTGAGTGTGTGGTTGGGTGG - Intergenic
904533593 1:31184446-31184468 TGAATGAGTGACTGCATGGATGG - Intronic
905118126 1:35660081-35660103 TGTGTGAGTGAGTGGGTGCAGGG + Intergenic
905241289 1:36583212-36583234 GGAGTGAGTGAGTGGGTAGATGG - Intergenic
905906300 1:41620773-41620795 AGGGTGAGTGACTGGGTGAATGG - Intronic
906108095 1:43306635-43306657 TTGGTGATTTACTGGGTGGCTGG + Intronic
906190816 1:43898580-43898602 GGACTGAGGGCCTGGGTGGCGGG + Intronic
906286329 1:44590224-44590246 TGAGTGATTGCCTGGAAGGCTGG - Intronic
906289411 1:44610176-44610198 TGAGTGTGTGAGTGCGTGGGGGG - Intronic
906312403 1:44763263-44763285 AGAGCAAGTGACTGGGAGGCAGG + Intronic
906515552 1:46437003-46437025 TGAGTGGGTGAATGGATGGTTGG - Intergenic
906585103 1:46968694-46968716 TGAGTGAGTGAGTGAGTGAAAGG + Intergenic
906790230 1:48652794-48652816 TGAGTGCGTGAGTGTGGGGCTGG + Intronic
907751172 1:57264697-57264719 TGAGTGAGAGCCTGGGAGGGTGG - Intronic
907825492 1:58012875-58012897 AGAGAGAGAGACTGTGTGGCAGG + Intronic
907839049 1:58138925-58138947 TGAATGAGTGAATAGGTGGGTGG + Intronic
908270622 1:62418271-62418293 TGAGTGGGTCACAGGGTGCCCGG - Intergenic
908444022 1:64184439-64184461 TGAGTCAGTGAGTGAGTGGTGGG + Intergenic
909056891 1:70832415-70832437 TGTGTGAGGGACTTGGTGGGAGG + Intergenic
910244344 1:85122706-85122728 TGAGTGACTGACAGGGGAGCAGG + Intronic
910346253 1:86242194-86242216 TGAGTCAGTGAGTGAGTGGTGGG + Intergenic
910422730 1:87084833-87084855 TGAGTGAGTGAGTGAGTGACAGG - Intronic
910645361 1:89508519-89508541 TGAGTCAGTTTCTGGGTGGGGGG + Intergenic
910905421 1:92172797-92172819 TGAGTGAGAAACTGGGAGACTGG + Intronic
911020465 1:93381921-93381943 TGATTGTGTGACTGGGTAGATGG - Intergenic
911104005 1:94116071-94116093 TGAGTGAGTGAGGGAGTGGGTGG - Intronic
912564526 1:110576951-110576973 TGAGTGAGTGAGTGAGTGAGTGG - Intergenic
912727920 1:112075841-112075863 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
912727922 1:112075845-112075867 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
912727924 1:112075849-112075871 TGAGTGGGTGGGTGGGTGGAGGG + Intergenic
912797832 1:112703583-112703605 TCATTCAGTGACTGGGGGGCGGG + Intronic
913963911 1:143359202-143359224 TGATTGAATGATTGGGTGGATGG + Intergenic
914058275 1:144184806-144184828 TGATTGAATGATTGGGTGGATGG + Intergenic
914120873 1:144781565-144781587 TGATTGAATGATTGGGTGGATGG - Intergenic
914848413 1:151295839-151295861 GGATTGAGTAAATGGGTGGCAGG - Intronic
915029389 1:152863832-152863854 TGAGTTAGTGAGTGAGTGGAGGG - Intergenic
915535325 1:156531920-156531942 TGAGTGAATGAGTGGGTGCAAGG + Intronic
915921946 1:159982408-159982430 TGAGTGAGTGAGTGTGCGGCAGG - Intergenic
916107989 1:161444448-161444470 TGTGTGAGTGAAGGGGTGGGTGG - Intergenic
916109575 1:161451830-161451852 TGTGTGAGTGAAGGGGTGGGTGG - Intergenic
916111159 1:161459235-161459257 TGTGTGAGTGAAGGGGTGGGTGG - Intergenic
916112748 1:161466621-161466643 TGTGTGAGTGAAGGGGTGGGTGG - Intergenic
918307273 1:183258787-183258809 TGAGTCAGTTCCTGGGTGGGGGG - Intronic
918505027 1:185244554-185244576 TGGGTGAGTCAGTGGGTGGGTGG + Intronic
919895665 1:202008342-202008364 TGGGTGAGGGACTGGGTGGAGGG + Exonic
920034536 1:203057221-203057243 TGAGTGAAAGATTGGGTGTCTGG + Intronic
920230016 1:204463992-204464014 GAAGTGAGTGAATGGGTGGGAGG - Exonic
920356389 1:205376333-205376355 TGTGTGAGAGACTGCATGGCAGG - Intergenic
920680152 1:208066049-208066071 TGAGTGAGTGTGTGTGTGGTGGG + Intronic
920940036 1:210473526-210473548 TGAGTCACTGACTGGGTGAATGG + Intronic
921715878 1:218416761-218416783 TGTGGGAGGGACTGGGTGGGAGG + Intronic
921825596 1:219668601-219668623 TGAGTGATTGGCTGGCTGGTTGG - Intergenic
922019295 1:221687799-221687821 TGAGTGTGTGTATGGGTGGAGGG - Intergenic
922310042 1:224380148-224380170 AGAGTGAGTGGGTGGGTGGTCGG + Intergenic
922526914 1:226310781-226310803 TGGGTGAGTCACTGGGTGTGAGG + Intergenic
922793012 1:228320922-228320944 TGAGTGAGTGGGTGGGTGACTGG - Intronic
922964357 1:229675615-229675637 TGAGTGGGTGTGTGGGTGGATGG - Intergenic
922964358 1:229675619-229675641 TGAGTGAGTGGGTGTGTGGGTGG - Intergenic
922964360 1:229675623-229675645 TGGGTGAGTGAGTGGGTGTGTGG - Intergenic
923215574 1:231845373-231845395 TGAGTGAGTGAATGGGAGGAAGG + Intronic
923434004 1:233951362-233951384 TGAGTCAGTGAGTGGGTGGTGGG - Intronic
923552865 1:234978170-234978192 TGAGTGAGTGAATAGGTGGATGG + Intergenic
923807529 1:237274679-237274701 TGAGTCAGTGAGTGAGTGGTGGG - Intronic
924154221 1:241159506-241159528 TGAGTAGGTGAGTGGGTGGGTGG - Intronic
924458400 1:244236737-244236759 AGACAGAGTGACAGGGTGGCTGG + Intergenic
1062943667 10:1444126-1444148 TGAGTGAGTGGGTGGGTAGATGG - Intronic
1062943673 10:1444158-1444180 TGAGTAAGTGGGTGGGTGGATGG - Intronic
1062943674 10:1444162-1444184 TGAATGAGTAAGTGGGTGGGTGG - Intronic
1062943679 10:1444186-1444208 TGAGTGGGTGAGTGGATGGATGG - Intronic
1062943706 10:1444325-1444347 TGAGTGGATGGCTGGGTGGATGG - Intronic
1062943764 10:1444640-1444662 TGAGTGAATGGGTGGGTGGATGG - Intronic
1062943765 10:1444644-1444666 TGAATGAGTGAATGGGTGGGTGG - Intronic
1062943771 10:1444672-1444694 TGAGTGAGTGGGTGGATGGATGG - Intronic
1062943772 10:1444676-1444698 TGAATGAGTGAGTGGGTGGATGG - Intronic
1063114041 10:3060688-3060710 TGAGTGAGTGAATGAGTGAGCGG - Intergenic
1063378500 10:5569316-5569338 TGAGTGAATGAGTGTGTGGTTGG + Intergenic
1064089429 10:12371187-12371209 TGAGTGAGTGAGTGAGTGAGTGG - Intronic
1064234251 10:13559280-13559302 TGAGTCAGTGAGTGAGTGGTGGG + Intergenic
1064300018 10:14115022-14115044 GGAGTGAGTGTATGGGTAGCAGG - Intronic
1064302473 10:14134624-14134646 TGAATGGGTGAATGGGTGGATGG + Intronic
1065136359 10:22674478-22674500 TGAATGTGTAACTGGATGGCTGG - Intronic
1066178827 10:32939749-32939771 TGAGTGAGTGAGTGAGTGAGAGG + Intronic
1066593816 10:37026046-37026068 TGGATGAGTAGCTGGGTGGCTGG + Intergenic
1067139602 10:43646040-43646062 TGAGTGAGTCAGTTGATGGCTGG - Intronic
1067709586 10:48637404-48637426 TGAGTGGGTGGATGGGTGGGTGG + Intronic
1068813903 10:61288021-61288043 TGTGTGGGTGAGTGGGTGGGTGG + Intergenic
1069713818 10:70508069-70508091 GGAATGAGTGATTGGGGGGCTGG + Intronic
1069735591 10:70652040-70652062 GGAGTCAGTGACTGGGTGGCAGG - Intergenic
1069824456 10:71246552-71246574 TTGGTGAGTGACTGGGTTGAGGG + Intronic
1070084697 10:73225701-73225723 TGAGTGAGTCACTGAGTGAGTGG - Intronic
1071505258 10:86228094-86228116 TGAGTGGGTGAGTAGGTGGGTGG + Intronic
1071505283 10:86228202-86228224 TGGGTGGGTGAGTAGGTGGCCGG + Intronic
1072038575 10:91586564-91586586 TGAATGAATGACTGAGTGGATGG - Intergenic
1072165191 10:92806258-92806280 TGAATGAGTGAATGGATGGTTGG + Intergenic
1072734904 10:97872604-97872626 TGAGTGAATCACTGGCTGGATGG + Intronic
1073086035 10:100889704-100889726 TCAGTGTGTGAGTGGGTGGGTGG + Intergenic
1073086036 10:100889708-100889730 TGTGTGAGTGGGTGGGTGGATGG + Intergenic
1074536341 10:114330881-114330903 GGAGTGGGTAACTGGGTGGTGGG + Intronic
1075196364 10:120362768-120362790 TCAGAGAGTGACTGGGGGGTGGG - Intergenic
1075216741 10:120543053-120543075 TGAGTGTGGGTGTGGGTGGCAGG + Intronic
1075512878 10:123086413-123086435 TGAGTGAGTGAGTGAGTGAATGG + Intergenic
1075512888 10:123086608-123086630 TGAGTGAGTGAGTGAGTGAACGG + Intergenic
1076158100 10:128219300-128219322 TGAGTGAGTGAGTGGGTGAGTGG - Intergenic
1076158110 10:128219340-128219362 TGAGTGGGTGAGTGGGTTGGTGG - Intergenic
1076158113 10:128219348-128219370 TGAGTGGGTGAGTGGGTGAGTGG - Intergenic
1076158115 10:128219356-128219378 TGAATGAGTGAGTGGGTGAGTGG - Intergenic
1076158119 10:128219384-128219406 TGAGTGAGTGGGTGAGTGGGTGG - Intergenic
1076158121 10:128219388-128219410 TGAGTGAGTGAGTGGGTGAGTGG - Intergenic
1076158127 10:128219420-128219442 TGAGTGAGTGGGTGGGTGAGTGG - Intergenic
1076158129 10:128219428-128219450 TGAGTGAGTGAGTGAGTGGGTGG - Intergenic
1076158139 10:128219512-128219534 TGAGTGAGTGGGTGGGTGAGTGG - Intergenic
1076158141 10:128219520-128219542 TGAGTGGGTGAGTGAGTGGGTGG - Intergenic
1076158151 10:128219556-128219578 TGAGTGGGTGAGTGAGTGACTGG - Intergenic
1076158153 10:128219572-128219594 TGAGTGTGTGAGTGGGTGAGTGG - Intergenic
1076278133 10:129223493-129223515 TGGGTGAGTGAGTGGGTGACTGG + Intergenic
1076278137 10:129223501-129223523 TGAGTGGGTGACTGGGTGGGTGG + Intergenic
1076278167 10:129223731-129223753 TGAATGAGTGAATGAGTGGGCGG + Intergenic
1076278183 10:129223827-129223849 TAAGTGAATGACTGGCTGGGTGG + Intergenic
1076278199 10:129223898-129223920 TGAGTGGATGACTGGCTGGGTGG + Intergenic
1076278227 10:129224013-129224035 TGGGTGAATGAGTGGGTGGGTGG + Intergenic
1076278280 10:129224245-129224267 TGAGTGAGTTAATGGGTGGGTGG + Intergenic
1076278304 10:129224376-129224398 TGGGTGAGTAAATGGGTGGATGG + Intergenic
1076578017 10:131483745-131483767 TGAGTCAGTGGATGGGTGGATGG + Intergenic
1076602825 10:131670061-131670083 TGGGTGAGTGAATGGATGGATGG + Intergenic
1076844981 10:133065567-133065589 TGAGTGGGTGGATGGGTGGATGG + Intergenic
1076845039 10:133065767-133065789 TGAGTGAGTGGATGGGTGGGTGG + Intergenic
1076845083 10:133065917-133065939 TGAGTGGGTGGATGGGTGGGTGG + Intergenic
1076845098 10:133065969-133065991 TGAGTGGGTGGATGGGTGGGTGG + Intergenic
1076845136 10:133066093-133066115 TGAGTGGGTGGATGGGTGGATGG + Intergenic
1076845154 10:133066147-133066169 TGAGTGGGTGGATGGGTGGAGGG + Intergenic
1076845182 10:133066232-133066254 TGAGTGGGTGGATGGGTGGATGG + Intergenic
1076845223 10:133066361-133066383 TGAGTGGGTGGATGGGTGGATGG + Intergenic
1076845264 10:133066493-133066515 TGAGTGGGTGGATGGGTGGATGG + Intergenic
1076845308 10:133066633-133066655 TGAGTGGGTGGATGGGTGGATGG + Intergenic
1076845350 10:133066745-133066767 TGAGTGGGTGGATGGGTGGATGG + Intergenic
1076867430 10:133174973-133174995 TGAGTGGGTGGATGGGTGGATGG + Intronic
1076867537 10:133175398-133175420 TGAATGGGTGAGTGGGTGGATGG + Intronic
1077094939 11:795316-795338 TGAGCATGGGACTGGGTGGCAGG - Intronic
1077150208 11:1069751-1069773 TGAGTGAGTGACTGGATAGGTGG - Intergenic
1077168574 11:1154548-1154570 TGGGTGAGTGAGTGAGTGGGTGG - Intergenic
1077171736 11:1169341-1169363 TGAGTGAGTGAATGGGTGAACGG - Intronic
1077171760 11:1169501-1169523 TGAGTGAGTGAATGGGTGAATGG - Intronic
1077171781 11:1169636-1169658 TGAGTGAGTGAATGGGTGAATGG - Intronic
1077171785 11:1169660-1169682 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171789 11:1169680-1169702 TGAGTGGGTGAATGGGTGAATGG - Intronic
1077171806 11:1169814-1169836 TGAGTGGGTGAATGGGTGAGTGG - Intronic
1077171808 11:1169822-1169844 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077171815 11:1169858-1169880 TGAGTGGGTGAGTGGGTGAATGG - Intronic
1077171817 11:1169866-1169888 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171825 11:1169914-1169936 CGAGTGAGTGAATGGGTGAATGG - Intronic
1077171831 11:1169946-1169968 TGAGTGGGTGAATGGGTGAGTGG - Intronic
1077171840 11:1169990-1170012 TGAGTGGGTGAATGGGTGAATGG - Intronic
1077171842 11:1169998-1170020 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077171860 11:1170115-1170137 TGAGTGAGTGAATGGGTGAATGG - Intronic
1077171866 11:1170147-1170169 TGAGTGAGTGAATGGGTGAATGG - Intronic
1077171872 11:1170179-1170201 TGAGTGAGTGAATGGGTGAATGG - Intronic
1077171878 11:1170211-1170233 TGAGTGAGTGAATGGGTGAATGG - Intronic
1077171884 11:1170243-1170265 TGAGTGAGTGAATGGGTGAATGG - Intronic
1077171888 11:1170267-1170289 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171892 11:1170287-1170309 TGAGTGGGTGAATGGGTGAATGG - Intronic
1077171907 11:1170385-1170407 TGAGTGGGTGAATGGGTGAGTGG - Intronic
1077171916 11:1170425-1170447 TGAGTGGGTGAATGGGTGAATGG - Intronic
1077171918 11:1170433-1170455 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077171925 11:1170469-1170491 TGAGTGGGTGAGTGGGTGAATGG - Intronic
1077171927 11:1170477-1170499 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171935 11:1170525-1170547 CGAGTGAGTGAATGGGTGAATGG - Intronic
1077171939 11:1170549-1170571 TGAGTGGGTGAGTGGGTGAGTGG - Intronic
1077171941 11:1170557-1170579 TGAGTGGGTGAGTGGGTGAGTGG - Intronic
1077171945 11:1170573-1170595 TGAGTGAGTGAGTAGGTGAGTGG - Intronic
1077171955 11:1170637-1170659 TGAGTGGGTGAATGGGTGAATGG - Intronic
1077171957 11:1170645-1170667 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077171964 11:1170681-1170703 TGAGTGGGTGAGTGGGTGAATGG - Intronic
1077171966 11:1170689-1170711 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171973 11:1170737-1170759 CGAGTGAGTGAATGGGTGAATGG - Intronic
1077171977 11:1170761-1170783 TGAGTGGGTGAGTGGGTGAGTGG - Intronic
1077171981 11:1170777-1170799 TGAGTGAGTGAATAGGTGAGTGG - Intronic
1077171986 11:1170813-1170835 TGAGTGGGTGAATGGGTGAATGG - Intronic
1077171988 11:1170821-1170843 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077172002 11:1170927-1170949 TGAGTGGGTGAATGGGTGAGTGG - Intronic
1077172019 11:1171008-1171030 TGAGTGGGTGAATGGGTGAATGG - Intronic
1077172021 11:1171016-1171038 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077172045 11:1171165-1171187 TGAGTGTGTGAATGGGTGAATGG - Intronic
1077172049 11:1171222-1171244 TGAATGAGTGAATGGGTGAGTGG - Intronic
1077172054 11:1171254-1171276 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172068 11:1171367-1171389 TGGGTGAGTGAATGGGTGAGTGG - Intronic
1077172088 11:1171477-1171499 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172092 11:1171497-1171519 TGAGTGGGTGAATGGGTGAATGG - Intronic
1077172094 11:1171505-1171527 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077172108 11:1171577-1171599 TGAGTGGGTGAGTGGGTGAATGG - Intronic
1077172110 11:1171585-1171607 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172118 11:1171633-1171655 TGAGTGAGTGAGTGGGTGAGTGG - Intronic
1077172122 11:1171657-1171679 TGAGTGGGTGAGTGGGTGAATGG - Intronic
1077172124 11:1171665-1171687 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172128 11:1171685-1171707 TGAGTGGGTGAGTGGGTGAATGG - Intronic
1077172130 11:1171693-1171715 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172137 11:1171737-1171759 TGAGTGGGTGAGTGGGTGAATGG - Intronic
1077172143 11:1171772-1171794 TGAGTGGGTGAATGGGTGAGTGG - Intronic
1077172145 11:1171780-1171802 TGAGTGGGTGAGTGGGTGAATGG - Intronic
1077172149 11:1171796-1171818 TGAGTGAGTGAATGGATGAGTGG - Intronic
1077172156 11:1171847-1171869 TGAGTGAGTGAATGGGTGAGTGG - Intronic
1077172168 11:1171907-1171929 TGAGTGAGTGAGTAGGTGAGTGG - Intronic
1077172334 11:1172699-1172721 TGAATGAGTGAATGGGTGGGTGG - Intronic
1077172346 11:1172770-1172792 TGGGTGAGTGAATGGGTGAACGG - Intronic
1077172356 11:1172818-1172840 TGAGTGAGTGAATGGGTGAGTGG - Intronic
1077172363 11:1172854-1172876 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077172384 11:1172946-1172968 TGAGTGAGTGAATGGGTGAGTGG - Intronic
1077172403 11:1173022-1173044 TGAGTGAGTGAATGGGTGAGTGG - Intronic
1077172418 11:1173337-1173359 TGAGTGAGTGAGTGGGTGAGTGG - Intronic
1077172425 11:1173437-1173459 TGAGTGAGTGAGTGGATGAGTGG - Intronic
1077213521 11:1384352-1384374 TGGGTGGGTGGGTGGGTGGCAGG - Intergenic
1077311995 11:1892976-1892998 TGAATGAGTAAGTGGGTGGGTGG + Intergenic
1077311997 11:1892980-1893002 TGAGTAAGTGGGTGGGTGGGTGG + Intergenic
1077312034 11:1893155-1893177 TGAATGAGTAAGTGGGTGGGTGG + Intergenic
1077312036 11:1893159-1893181 TGAGTAAGTGGGTGGGTGGGTGG + Intergenic
1077312137 11:1893597-1893619 TGAGTGAGTGAATGGGTAGGTGG + Intergenic
1077312193 11:1893874-1893896 TGAGTGAGTGAATGGATAGGTGG + Intergenic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077319082 11:1932940-1932962 TGAGTGTATGAATGGGTGGTTGG - Intronic
1077319114 11:1933124-1933146 TGAATGGGTGAATGGGTGGGTGG - Intronic
1077319123 11:1933152-1933174 TGAGTGGGTGGGTGGGTGGATGG - Intronic
1077319124 11:1933156-1933178 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1077357425 11:2125012-2125034 TGAGTGGGTGAGTGGGTAGATGG + Intergenic
1077357554 11:2125659-2125681 TGAGTGGGTGAGTGGGTGAGTGG + Intergenic
1077357556 11:2125667-2125689 TGAGTGGGTGAGTGGGTAGATGG + Intergenic
1077357635 11:2126057-2126079 TAAGTGGGTGAGTGGGTGGATGG + Intergenic
1077357715 11:2126445-2126467 TAAGTGGGTGAGTGGGTGGGTGG + Intergenic
1077357728 11:2126490-2126512 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1077357791 11:2126764-2126786 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1077357793 11:2126768-2126790 TGAGTGAGTGGGTGAGTGGGTGG + Intergenic
1077599732 11:3565994-3566016 TGAGTGGGTGAGGGGGTGGCGGG + Intergenic
1078400562 11:11022764-11022786 TGGGTGGGTGGCTGGGTGGATGG - Intergenic
1078550653 11:12278075-12278097 TGGGTGAGTGAGTGGGTGAGTGG + Intronic
1078714327 11:13825632-13825654 TGAGTGAATGACTGGCTGGTTGG - Intergenic
1078852199 11:15174547-15174569 TGAGTGAATGAGCTGGTGGCAGG + Intronic
1078867420 11:15311051-15311073 TGAATGAATGAGTGGGTGGGTGG - Intergenic
1079003443 11:16776237-16776259 TGAGTGAGTGACTGTGTGACAGG - Intergenic
1080606483 11:33869148-33869170 TGGGAGAGGGACTGGGCGGCGGG - Intronic
1080651135 11:34223503-34223525 TGAGTGAGTGTGTGTGTGGTTGG - Intronic
1080740232 11:35057202-35057224 TGAGGGATTAACTGTGTGGCAGG - Intergenic
1081271914 11:41095313-41095335 TGAGGGAGGGACTTGGTGGGAGG - Intronic
1081487986 11:43546797-43546819 TGATGGAGGGACTGGGTGACAGG - Intergenic
1081611991 11:44568402-44568424 TGGGTGAGTGGCGGGGTTGCTGG + Intronic
1081649547 11:44814682-44814704 TGAGTGGGTGGGTGGGTGGATGG - Intronic
1081649548 11:44814686-44814708 TGAATGAGTGGGTGGGTGGGTGG - Intronic
1082967650 11:58984095-58984117 GGGGTGGGTGACTGGGGGGCTGG - Intronic
1083201312 11:61122711-61122733 TGGGTGGGTGAGTGGGTAGCAGG + Intronic
1083288212 11:61674544-61674566 TGTGTGGGTGAATGGGTGGATGG + Intergenic
1083615909 11:64026371-64026393 TCAGTGGGAGAATGGGTGGCTGG - Intronic
1083617838 11:64035402-64035424 TGAATGAATGAATGGATGGCTGG + Intronic
1083791958 11:64991529-64991551 TGAGTGAGTGACTCCGTTCCTGG - Intronic
1083828385 11:65216075-65216097 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828413 11:65216266-65216288 TGAGTGAGTGGGTGGGTGAATGG + Intergenic
1083828420 11:65216290-65216312 TAAGTGAGTGGGTGGGTGGGTGG + Intergenic
1083828430 11:65216382-65216404 TGAGTGAGTGGATGAGTGGGTGG + Intergenic
1083828432 11:65216386-65216408 TGAGTGGATGAGTGGGTGGGTGG + Intergenic
1083828438 11:65216402-65216424 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1083828448 11:65216434-65216456 TGGGTGAATGAGTGGGTGGGTGG + Intergenic
1083828450 11:65216438-65216460 TGAATGAGTGGGTGGGTGGGTGG + Intergenic
1083828454 11:65216458-65216480 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1083828456 11:65216462-65216484 TGAGTGAGTGGGTGAGTGGGTGG + Intergenic
1083828458 11:65216466-65216488 TGAGTGGGTGAGTGGGTGGGTGG + Intergenic
1083828465 11:65216534-65216556 TGAGTGAGTGAGTGAGTGGGTGG + Intergenic
1083828470 11:65216558-65216580 TGAATGAGTGAGTAGGTGGGTGG + Intergenic
1083828478 11:65216590-65216612 TGGGTGAGTGAGTGCGTGGGTGG + Intergenic
1083828482 11:65216610-65216632 TGGGTGAGTGAGTGCGTGGGTGG + Intergenic
1083828488 11:65216634-65216656 TGAGTGAGTGGGTGGGTGAGTGG + Intergenic
1083828496 11:65216698-65216720 TGAGTGAGTGGGTGGGTGAGTGG + Intergenic
1083828509 11:65216738-65216760 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828511 11:65216742-65216764 TGAGTGAGTGGGTGGGTGGGTGG + Intergenic
1083828515 11:65216762-65216784 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1083828517 11:65216766-65216788 TGAGTGAGTGGGTGAGTGGGTGG + Intergenic
1083828523 11:65216786-65216808 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828529 11:65216810-65216832 TGAGTGAGTGGGTGGGTGAGTGG + Intergenic
1083828537 11:65216834-65216856 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083840997 11:65304295-65304317 TGAGTGGGTGGGTGGGTGGATGG - Intronic
1084285441 11:68128102-68128124 TGAGTGACTGACAGGGAGGCAGG + Intergenic
1084413461 11:69016971-69016993 TGGGTGAGTGGGTGGGTGGATGG - Intergenic
1084464398 11:69313703-69313725 TGAGTGGGTGAATGGGTGGATGG - Intronic
1084536821 11:69762291-69762313 TGGGTCACTGACTGGATGGCTGG + Intergenic
1084545906 11:69815024-69815046 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1084596345 11:70119121-70119143 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1084667741 11:70585571-70585593 TGAATGAATGAGTGGGTGGGCGG - Intronic
1084685718 11:70693962-70693984 TGGCTGAGTGAGTGGATGGCGGG + Intronic
1084699434 11:70776881-70776903 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1084699474 11:70777057-70777079 TGAGTGGGTGAATGGATGGATGG - Intronic
1084699476 11:70777065-70777087 TGAGTGAATGAGTGGGTGAATGG - Intronic
1084776498 11:71380379-71380401 TGAGTGGGTGGGTGGGTGGATGG + Intergenic
1084776531 11:71380507-71380529 TGAGTGGGTGGGTGGGTGGATGG + Intergenic
1084776565 11:71380631-71380653 TGAGTGGGTGGGTGGGTGGATGG + Intergenic
1084776595 11:71380755-71380777 TGAATGAGTGGGTGGGTGGATGG + Intergenic
1084776624 11:71380874-71380896 TGAATGAGTGGATGGGTGGGTGG + Intergenic
1084792968 11:71486459-71486481 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1084792969 11:71486463-71486485 TGAGTGGGTGAGTGGGTGGGTGG - Intronic
1084793782 11:71491035-71491057 TGAGTGTGGGCCAGGGTGGCCGG - Intronic
1084817112 11:71654718-71654740 TGAGTGGGTGAGGGGGTGGAGGG - Intergenic
1085031470 11:73273471-73273493 TGTGTGTGTGACTGGCTGGGTGG + Intronic
1085031472 11:73273475-73273497 TGTGTGACTGGCTGGGTGGGTGG + Intronic
1085034585 11:73292408-73292430 TGGGTGAGTGAATGGCTGGGAGG + Intronic
1085228547 11:74944876-74944898 TGAATGAGTAACTTGCTGGCTGG + Intronic
1085464298 11:76713583-76713605 TGGATGAGTGAATGGGTGGGTGG + Intergenic
1085464299 11:76713587-76713609 TGAGTGAATGGGTGGGTGGCTGG + Intergenic
1085464302 11:76713595-76713617 TGGGTGGGTGGCTGGGTGGATGG + Intergenic
1085528590 11:77178352-77178374 TGAGTGAATGGATGGGTGGGTGG - Intronic
1085776751 11:79373407-79373429 TGGCTGGGTGACTGGCTGGCTGG + Intronic
1085776752 11:79373411-79373433 TGGGTGACTGGCTGGCTGGCTGG + Intronic
1085787493 11:79467460-79467482 TGAGTGAGTGAGTGAGTGAGTGG + Intergenic
1085789049 11:79480225-79480247 TGACTGAGTGAATGGATGGGTGG + Intergenic
1085789050 11:79480229-79480251 TGAGTGAATGGATGGGTGGATGG + Intergenic
1085794017 11:79520323-79520345 TGGGAGAGAGACTGGGAGGCAGG - Intergenic
1085894494 11:80622275-80622297 TGGATGAGTAGCTGGGTGGCTGG - Intergenic
1086861621 11:91931357-91931379 TGTTTGAGTGACTGGGAGGATGG + Intergenic
1087114128 11:94505736-94505758 TGAGTCAGTGAGTGAGTGGTGGG - Intergenic
1087713964 11:101585151-101585173 TGGGTGGGTGAGTGGGTGGGTGG + Intronic
1087713966 11:101585155-101585177 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1087713967 11:101585159-101585181 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1087871947 11:103305742-103305764 TGAGTGAGTGAATGAGTTGATGG + Intronic
1088355314 11:108937210-108937232 GGAGTGAGGGACTGGGAGGAAGG + Intronic
1088858648 11:113779732-113779754 TGGGTCAGTGACTGGTTAGCAGG - Exonic
1089013146 11:115146498-115146520 TGAGTGAGGGACCTGGTGGGAGG + Intergenic
1089388244 11:118081925-118081947 TCAGTGAGTGAGTGAGTGTCAGG - Intronic
1089605879 11:119641006-119641028 TAAGTGAGTGAGTGAGTGGAAGG - Intronic
1089615474 11:119692418-119692440 TGTGTGTGTGTGTGGGTGGCGGG + Intronic
1089651100 11:119913646-119913668 TCAGTGGGTGACTGGGGGCCAGG - Intergenic
1089753720 11:120670451-120670473 TGAGTGAGAGGCAGGGTGGTAGG - Intronic
1089808736 11:121114697-121114719 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089808746 11:121114729-121114751 TGGGTGGGTGAATGGGTGGATGG - Intronic
1089808758 11:121114765-121114787 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1089808782 11:121114833-121114855 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089808791 11:121114865-121114887 TGAGTGGGTGAATGGGTAGATGG - Intronic
1089808812 11:121114949-121114971 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089808822 11:121114981-121115003 TGAGTGGGTGAATGGGTGGATGG - Intronic
1089808844 11:121115065-121115087 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089808854 11:121115097-121115119 TGAGTGGGTGAATGGGTGGATGG - Intronic
1089808866 11:121115145-121115167 TGGGTGGGTGAATGGGTGGATGG - Intronic
1089808887 11:121115213-121115235 TGGGTGGGTGAATGGGTGGATGG - Intronic
1089988741 11:122837884-122837906 TGAGTGAGTGGGTGGATGGAAGG + Intergenic
1090153599 11:124412321-124412343 TGAGTCAGTGAGTGAGTGGCAGG + Intergenic
1090443811 11:126746583-126746605 AGATTGGGTGACTGGGTGGCTGG - Intronic
1090646592 11:128771381-128771403 TGTGTGAGAATCTGGGTGGCAGG - Intronic
1090994486 11:131852938-131852960 TGAGTGGATGAATGGGTGGGTGG - Intronic
1091069724 11:132551652-132551674 TGAGTCAGTTCCTGGGTGGAGGG - Intronic
1091133616 11:133167828-133167850 TGGTTGGGTGACTGGGTGGGTGG - Intronic
1091227811 11:133968129-133968151 TGAGAAAGTGTGTGGGTGGCAGG - Intergenic
1091670082 12:2446449-2446471 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1091670084 12:2446453-2446475 TGAGTGGGTGGGTGGGTGGGTGG + Intronic
1091783311 12:3227598-3227620 TGAGGGAGTGTTTGTGTGGCAGG + Intronic
1092262720 12:6961086-6961108 TGAGGGAGTGAGAGGGTAGCTGG - Intronic
1092944473 12:13440088-13440110 TGAGGGAGGGACTTGGTGGGAGG - Intergenic
1093691451 12:22114164-22114186 TGAGTCAGTTCCTGGGTGGGGGG - Intronic
1093835019 12:23818482-23818504 TGGGTGAGTCAGTGAGTGGCAGG + Intronic
1093872383 12:24307524-24307546 TGGGTGAGTGGGTGGGTGGGGGG - Intergenic
1094268089 12:28581235-28581257 TGAATGTGTGATTGCGTGGCGGG + Intergenic
1095733906 12:45535820-45535842 TGGGTGAATGAATGGGTGGATGG - Intergenic
1095887689 12:47206059-47206081 TGAGTCAGTTCCTGGGTGGAGGG + Intronic
1096101082 12:48970831-48970853 TGAGTGTGTGTCTGTGTGCCGGG - Intronic
1096458803 12:51810297-51810319 TGAGTGAGTGAGCAGGTGGAAGG - Exonic
1096524638 12:52203318-52203340 TGTGTGTGTGAGTGTGTGGCTGG + Intergenic
1096611224 12:52803289-52803311 TGAGTGAATGGCTGGGTGGATGG + Intergenic
1096716996 12:53497647-53497669 TGAGTGAATGCATGAGTGGCTGG + Intronic
1096863802 12:54549498-54549520 GGAGTGAGAGACTGGCGGGCAGG + Exonic
1097485186 12:60188107-60188129 AGAGTGAGTTCCTGGGAGGCAGG - Intergenic
1097798633 12:63889236-63889258 CGAGTGAGTGATTGGGTGACAGG + Intronic
1098683120 12:73382883-73382905 TGTGTGTGTGTGTGGGTGGCGGG - Intergenic
1099011520 12:77297004-77297026 TGAATGAATGAATGGGTGGGTGG - Intergenic
1099097163 12:78389032-78389054 TGGCTTAGTGACTAGGTGGCAGG + Intergenic
1099804340 12:87498829-87498851 TGAGGTGGTGACGGGGTGGCCGG + Intergenic
1099851046 12:88097927-88097949 TGTGTGTGTGGGTGGGTGGCAGG + Intronic
1100294593 12:93248919-93248941 TGAGTCAGTCCCTGGGTGGGGGG + Intergenic
1100619154 12:96255157-96255179 TTGGTGACTGACTGGGTGGGAGG + Intronic
1101015945 12:100500620-100500642 TGAGGGAGAGACTTGGTGACAGG + Intronic
1101328515 12:103738090-103738112 TGAGTGAGTGACTGAATAGAGGG - Intronic
1101749727 12:107573431-107573453 TGAATGAATGGATGGGTGGCTGG + Intronic
1101822298 12:108193429-108193451 TGAGTGGATGACTGGATGGGTGG + Intronic
1101834744 12:108287400-108287422 TGAGTGGGTGAATGGGTGGGTGG + Intergenic
1101834770 12:108287519-108287541 TGAGTGGGTGAATGGGTGGGTGG + Intergenic
1101950708 12:109172494-109172516 TGAGTGAGTCCCAGGGTGGAAGG + Intronic
1102452737 12:113053879-113053901 TGGGTGAATGACTGGATGGATGG + Intergenic
1102504222 12:113373715-113373737 TGAGTGGGTGGGTGGGTGGAAGG - Intronic
1102504223 12:113373719-113373741 TGAGTGAGTGGGTGGGTGGGTGG - Intronic
1102504247 12:113373862-113373884 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
1102507100 12:113390531-113390553 TGGATGAGTGAATGGGTGGATGG - Exonic
1102640203 12:114360525-114360547 TGAGTGAGTGGTTGGGTAGGTGG + Intronic
1102640243 12:114360704-114360726 TGAATGAGTGAGTGGGTGGATGG + Intronic
1102640245 12:114360708-114360730 TGAGTGAGTGGGTGGATGGGTGG + Intronic
1102640247 12:114360712-114360734 TGAGTGGGTGGATGGGTGGGTGG + Intronic
1102884895 12:116513997-116514019 TGAGGGAGGGACCTGGTGGCAGG + Intergenic
1103002472 12:117395870-117395892 TGAGTGAATGAATGGATGGCTGG - Intronic
1103027213 12:117583350-117583372 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1103027215 12:117583354-117583376 TGAGTGAGTGGGTGGGTGGGTGG + Intronic
1103027216 12:117583358-117583380 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1103027224 12:117583394-117583416 TGGGTGAGTGAGTGGATGGATGG + Intronic
1103027225 12:117583398-117583420 TGAGTGAGTGGATGGATGGATGG + Intronic
1103980950 12:124736631-124736653 TGCGTGGGTGCGTGGGTGGCCGG - Intergenic
1104196590 12:126545480-126545502 TGAGTGAGTGAGTGAGTGGTGGG + Intergenic
1104378817 12:128288951-128288973 TGAATGTGTGACTGTGTGGGGGG - Intronic
1104378822 12:128289044-128289066 TGAGTGTGTGAATGTGTGGGAGG - Intronic
1104528085 12:129543200-129543222 TGAGTTGGTGAGTGGGTGGGTGG + Intronic
1104528088 12:129543208-129543230 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1104528098 12:129543240-129543262 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1104528110 12:129543279-129543301 TGAGTAAGTGGGTGGGTGGGTGG + Intronic
1104659953 12:130604471-130604493 TGAGTGAGTGAGTGAGTGAGTGG - Intronic
1104754247 12:131259063-131259085 TGAGTGAGTGAATGGGTGCATGG + Intergenic
1104754251 12:131259087-131259109 TGAGTGAGTGAATGGGTGCGCGG + Intergenic
1104754255 12:131259119-131259141 TGAGTGAGTGAGTGAGTGAATGG + Intergenic
1104754259 12:131259151-131259173 TGAGTGAGTGAATGGGTGCATGG + Intergenic
1104754263 12:131259175-131259197 TGAGTGAGTGAATGGGTGCATGG + Intergenic
1104754273 12:131259227-131259249 TGAGTGAGTGAATGGGTGCATGG + Intergenic
1104754281 12:131259283-131259305 TGAGTGAGTGAATGGGTTCATGG + Intergenic
1104754285 12:131259307-131259329 TGAGTGAGTGAAAGGGTGCACGG + Intergenic
1104754295 12:131259375-131259397 TGAGTGAGTGAGTGAGTGAATGG + Intergenic
1104754297 12:131259383-131259405 TGAGTGAGTGAATGGGTGCATGG + Intergenic
1104754312 12:131259475-131259497 TGAGTGACTGAATGGGTGCATGG + Intergenic
1104754318 12:131259507-131259529 TGAGTGAGTGAATGGGTGCATGG + Intergenic
1104754328 12:131259567-131259589 TGAGTGAGTGAATGGGTACATGG + Intergenic
1104754334 12:131259599-131259621 TGAGTGACTGAGTGGGTGCATGG + Intergenic
1104754342 12:131259631-131259653 GGAGTGAGTGAATGGGTGCATGG + Intergenic
1104754346 12:131259659-131259681 TGAGTGAGTGAATGGGTGCATGG + Intergenic
1104754350 12:131259687-131259709 TGAGTGAGTGAATGGGTGTATGG + Intergenic
1104754358 12:131259747-131259769 TGAGTGAGTGAATGGGTACATGG + Intergenic
1104754364 12:131259779-131259801 TGAGTGACTGAGTGGGTGCATGG + Intergenic
1104754372 12:131259811-131259833 GGAGTGAGTGAATGGGTGCATGG + Intergenic
1104754376 12:131259839-131259861 TGAGTGAGTGAATGGGTGCATGG + Intergenic
1104754380 12:131259867-131259889 TGAGTGAGTGAATGGGTGTATGG + Intergenic
1104754384 12:131259895-131259917 TGAGTGAGTGAATGGGTGCATGG + Intergenic
1104754390 12:131259963-131259985 TGAGTGAGTGAATGGGTGCACGG + Intergenic
1104754394 12:131259995-131260017 TCAGTGAGTGAATGGGTGCACGG + Intergenic
1104778189 12:131403522-131403544 TGAGTGAGTGAGTTGGGGGGTGG - Intergenic
1104778635 12:131405489-131405511 TGAATGGGTGAATGGGTGGATGG - Intergenic
1104906713 12:132217466-132217488 TGGGTGGGTGAATGGATGGCTGG - Intronic
1104925690 12:132313065-132313087 TGGGTGGGTGAGTGGGTGGATGG - Intronic
1104925765 12:132313321-132313343 TGGGTGAGTGGATGGGTGGATGG - Intronic
1104925778 12:132313369-132313391 TGAGTGAGTGAGTGGATGGGTGG - Intronic
1104925780 12:132313373-132313395 TGGGTGAGTGAGTGAGTGGATGG - Intronic
1104925844 12:132313594-132313616 TGAGTGGATGTCTGGGTGGATGG - Intronic
1104925907 12:132313814-132313836 TGGGTGGGTGGCTGGGTGGGTGG - Intronic
1104954444 12:132457520-132457542 CGGGTGAGTGGCTGGGTGGGCGG + Intergenic
1104954455 12:132457552-132457574 TGAGTGGATGGCTGGGTGGGTGG + Intergenic
1104954531 12:132457782-132457804 TGAGTGGGTGGGTGGGTGGACGG + Intergenic
1104954628 12:132458074-132458096 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1105279643 13:18955941-18955963 TGAATGAGTGGATGGGTGGGTGG - Intergenic
1105586019 13:21743476-21743498 TGGGTGAGTGGATGGGTGGATGG - Intergenic
1105637673 13:22231221-22231243 TGGGTGAGTGAGTGGATGGATGG - Intergenic
1106073248 13:26434575-26434597 GGCATGGGTGACTGGGTGGCTGG + Intergenic
1106337202 13:28795183-28795205 TAAGTAAGTCACTGAGTGGCTGG - Intergenic
1106802193 13:33267608-33267630 TGAGTGAGTGAGTGAGTGAATGG + Intronic
1106826620 13:33529497-33529519 TGAATGAATGACTGGCTGGCTGG - Intergenic
1106997253 13:35500338-35500360 TGAGTGCATGACTGTGTGTCAGG + Intronic
1107074963 13:36313495-36313517 TGAGTGAGTCACTGAGTGAGTGG - Intronic
1107667634 13:42708440-42708462 TGAGTGAGTGGCCGGGGCGCTGG - Intergenic
1107842374 13:44472463-44472485 TGAGTGAGTGAGTGGGTGAGAGG - Intronic
1107874542 13:44778509-44778531 TGAGTCAGTGAGTGAGTGGTGGG + Intergenic
1108475677 13:50814356-50814378 TGAGTGAGTGGACGGCTGGCTGG - Intronic
1108475678 13:50814360-50814382 TGAGTGAGTGAGTGGACGGCTGG - Intronic
1109300905 13:60589183-60589205 TGAGTCAGTTCCTGGTTGGCAGG - Intergenic
1109645673 13:65251447-65251469 TGAGTGGGTGGGTGAGTGGCAGG + Intergenic
1110033093 13:70643094-70643116 TGTGTGTGTGTCGGGGTGGCAGG - Intergenic
1110472749 13:75878199-75878221 TGAGAGTGGAACTGGGTGGCTGG + Intronic
1110705181 13:78596411-78596433 TGAGTGAGTGAGGGGAGGGCGGG + Intergenic
1112258080 13:97852833-97852855 TGAGTGGATGAATGGGTGGGTGG + Intergenic
1112740293 13:102465546-102465568 AGAGGGAGTGACAGGGTAGCCGG + Intergenic
1113080261 13:106512149-106512171 TGAGTGAATGAATGGATGGATGG + Intronic
1113370202 13:109717589-109717611 TGAGTGAGTGAATGGTGGGCAGG + Intergenic
1113571015 13:111357838-111357860 TGTGAGAGTTGCTGGGTGGCAGG - Intergenic
1113581776 13:111435082-111435104 TGAGTGAGTGGGTAGGTGGGTGG + Intergenic
1113699659 13:112375142-112375164 TGAGGGAGGGACTTGGTGGGAGG + Intergenic
1113777769 13:112958504-112958526 CGAGGGTGGGACTGGGTGGCGGG + Intronic
1113780212 13:112972459-112972481 TGAGTGGGTGTGTGGGTGGATGG + Intronic
1113888199 13:113672012-113672034 TGAGAGAGTGCGTGGGGGGCGGG + Intronic
1113912674 13:113851316-113851338 TGAGTGAATGAATGAGTGGGTGG + Intronic
1113912675 13:113851320-113851342 TGAATGAATGAGTGGGTGGATGG + Intronic
1113912708 13:113851566-113851588 TGAGTGGGTGAATGGGTGACTGG + Intronic
1113912710 13:113851574-113851596 TGAATGGGTGACTGGATGGATGG + Intronic
1113912720 13:113851656-113851678 TGAATGAATGAGTGGGTGGATGG + Intronic
1114094873 14:19326188-19326210 TGAGAGAGTGAGGGGGAGGCAGG + Intergenic
1114282268 14:21204117-21204139 TGAGGGAGGGACTCGGTGGGAGG - Intergenic
1114702914 14:24696712-24696734 TGAGTGAGTGAGTGAGTGGAAGG + Intergenic
1114987407 14:28248391-28248413 TGAGGGAGTCAATGGGTGGCTGG - Intergenic
1115458892 14:33636535-33636557 TAAGTGAGTGACTACATGGCAGG - Intronic
1116095786 14:40365043-40365065 GGAGTGAGAGACAGGATGGCAGG + Intergenic
1116541398 14:46106885-46106907 TGTATGAGTGACTGGGTGTGGGG + Intergenic
1116789582 14:49326374-49326396 TGAGGGAGGGACTTGGTGGGAGG + Intergenic
1117163140 14:53008494-53008516 TGAGGGAAGGACTGGGTGGAAGG + Intergenic
1118366691 14:65102433-65102455 TGAGTGAGTGTGTGTGTGGGGGG - Exonic
1118366695 14:65102437-65102459 TGAGTGAGTGAGTGTGTGTGTGG - Exonic
1118371603 14:65141934-65141956 TGGGTGGGTGGGTGGGTGGCTGG - Intergenic
1119148706 14:72338893-72338915 GGAGTGAGTAACTGTGTGGCAGG + Intronic
1119191849 14:72688268-72688290 TGAGTGGGTGGGTGGGTGGGTGG + Intronic
1119341904 14:73886638-73886660 TGAGTGAGTGAGTGGGAGCGGGG + Exonic
1119410985 14:74430083-74430105 TGAGTGAGTGTGTGCCTGGCAGG - Intergenic
1119478738 14:74946863-74946885 GGAGTGAGCGACGGGGTGGGAGG + Intronic
1119635555 14:76270450-76270472 TGAGTGAGTAAGAGGGTGGGTGG - Intergenic
1119732473 14:76959534-76959556 TGGGTGAGTCACTAAGTGGCTGG - Intergenic
1120208750 14:81613558-81613580 TGAGGGAGGGACTTGGTGGAAGG - Intergenic
1121050139 14:90815100-90815122 AGAGTGAATGAATGGATGGCGGG - Intronic
1121087398 14:91157048-91157070 TGAATGGGTGAGTGGGTGGATGG + Intronic
1121277509 14:92678202-92678224 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1121817508 14:96939916-96939938 TGAGTGGGGGAGTGGGAGGCTGG - Intergenic
1121899555 14:97680987-97681009 TGAGTGAATGAGTGAGTGGCAGG - Intergenic
1121918384 14:97857061-97857083 TGAGTCAGTGGGTGGGTGGATGG + Intergenic
1122005432 14:98699513-98699535 TGAGAGAGTGAGTCAGTGGCTGG - Intergenic
1122251819 14:100445098-100445120 AGAGTGAGTGAGAGGGTGCCTGG - Intronic
1122741710 14:103875399-103875421 TGGGTGAGTGAATGGATGGATGG + Intergenic
1122867633 14:104614651-104614673 TGAATGAGTGAGTGAGTGGGTGG + Intergenic
1122867635 14:104614655-104614677 TGAGTGAGTGAGTGGGTGGGTGG + Intergenic
1122867636 14:104614659-104614681 TGAGTGAGTGGGTGGGTGGATGG + Intergenic
1122923672 14:104890275-104890297 TGGATGAGTGAGTGGGTGGATGG + Intronic
1122923673 14:104890279-104890301 TGAGTGAGTGGGTGGATGGATGG + Intronic
1122923682 14:104890303-104890325 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1122923683 14:104890307-104890329 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1122923708 14:104890423-104890445 TGGATGAGTGAGTGGGTGGATGG + Intronic
1122923715 14:104890443-104890465 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1122923752 14:104890587-104890609 TGGGTGAGTGAGTGGGTGGATGG + Intronic
1122923753 14:104890591-104890613 TGAGTGAGTGGGTGGATGGATGG + Intronic
1122923768 14:104890655-104890677 TGGATGAGTGAGTGGGTGGATGG + Intronic
1122923769 14:104890659-104890681 TGAGTGAGTGGGTGGATGGATGG + Intronic
1122923777 14:104890683-104890705 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1122923791 14:104890746-104890768 TGGATGAGTGAGTGGGTGGATGG + Intronic
1122923792 14:104890750-104890772 TGAGTGAGTGGGTGGATGGATGG + Intronic
1122923816 14:104890846-104890868 TGAATGAGTGGGTGGGTGGGTGG + Intronic
1122923817 14:104890850-104890872 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1123146280 14:106133671-106133693 TGAGTGTGTGTGTGTGTGGCGGG - Intergenic
1123872758 15:24593317-24593339 TGAGTCAGTTCCTGGGTGGGGGG + Intergenic
1124192211 15:27589805-27589827 TGAGTGTGTGAGTGGGTGCGTGG - Intergenic
1124350082 15:28948878-28948900 TGAGTGAGAGGCTGGGGGGTTGG + Intronic
1124658695 15:31528041-31528063 TGAGTGGGTGCGTGGGTGGGTGG - Intronic
1124658697 15:31528045-31528067 TGAGTGAGTGGGTGCGTGGGTGG - Intronic
1125080867 15:35671377-35671399 TGAGTGAGTCACTGAGTCACAGG - Intergenic
1125411324 15:39409295-39409317 TGAGTGGGTGGGTGGGTGGATGG + Intergenic
1125818115 15:42603745-42603767 TGAGTCAGTTATTGGGTGGGAGG + Intronic
1126163909 15:45637656-45637678 TGTGTGCGTGTCTGTGTGGCTGG + Intronic
1126257760 15:46647944-46647966 TGAGTGTGTGAGTGGGTGGGAGG + Intergenic
1126843149 15:52736430-52736452 TGAGAGAGGGACCGGGTGGGAGG + Intergenic
1127453468 15:59138174-59138196 TAAGTGTGTGGCTGGTTGGCTGG - Intronic
1127898016 15:63319973-63319995 TGGGTGAGTGAGTGAGTGGAGGG - Intergenic
1128240982 15:66100837-66100859 TGAGTGAGCCACTGGATGGGTGG + Intronic
1128241013 15:66100977-66100999 TGAGCCAGTGAGTGGGTGGTGGG + Intronic
1128248200 15:66147328-66147350 TGAGTGAATGACTGGATGAAGGG - Intronic
1129092702 15:73168142-73168164 AGAGTGAGGGACTGTGTGTCAGG + Intronic
1129261394 15:74369895-74369917 TTTCTGGGTGACTGGGTGGCTGG + Intergenic
1129261397 15:74369903-74369925 TGACTGGGTGGCTGGGTGGCTGG + Intergenic
1129261402 15:74369919-74369941 TGGCTGGGTGACTGGGTGGCTGG + Intergenic
1129475388 15:75781491-75781513 GGAGAGAGTAACAGGGTGGCTGG + Intergenic
1129549074 15:76428984-76429006 TGAGGGAGGGACTTGGTGGGAGG + Intronic
1130021821 15:80238185-80238207 TGAGTCATTGACTGAGTGGTGGG - Intergenic
1130106665 15:80933482-80933504 TGAGTGAATAAGTGAGTGGCCGG - Intronic
1131266196 15:90916733-90916755 TGCACGAGTGACTGAGTGGCGGG - Intronic
1131617182 15:94028866-94028888 TGAATGACTGACTGGCAGGCTGG + Intergenic
1132351550 15:101142489-101142511 TGAATAAGTGAATGGGTGGATGG - Intergenic
1132644719 16:993641-993663 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1132644774 16:993829-993851 TGGGTGAGTGAGTGGGTGGACGG - Intergenic
1132654050 16:1034432-1034454 TGAGTGGCTGGCTGGCTGGCTGG - Intergenic
1132654051 16:1034436-1034458 TGGATGAGTGGCTGGCTGGCTGG - Intergenic
1132976867 16:2715455-2715477 GGAGTGGGTGAGTGGGTGGAGGG + Intronic
1133111601 16:3551228-3551250 TGAGTGGGTGGGTGGGTGGATGG - Intronic
1133111602 16:3551232-3551254 TGAGTGAGTGGGTGGGTGGGTGG - Intronic
1133111604 16:3551236-3551258 TGAATGAGTGAGTGGGTGGGTGG - Intronic
1133204897 16:4227350-4227372 TGGGTGAATGGCTGGGTGGAAGG + Intronic
1133231475 16:4369082-4369104 TGAGTCAGTGGCTGGCTGGCTGG - Intronic
1133372468 16:5255584-5255606 TGAGTGGGTGAATGGGTGGAGGG - Intergenic
1133383101 16:5347660-5347682 TGATTGAGTGAAAGGGTGGGTGG - Intergenic
1133383153 16:5347846-5347868 TGAGTGAAAGAGTGGGTGGATGG - Intergenic
1133399391 16:5473696-5473718 TGAGTGGGTGGGTGGGTGGGTGG + Intergenic
1133454373 16:5930276-5930298 TGAGTAGGTGAGTGGGTGGGAGG + Intergenic
1133462661 16:6000670-6000692 TGAATGGGTGACTAGGTGGATGG + Intergenic
1133469335 16:6058804-6058826 TGAGTGGGTAAGTGGGTGGATGG - Intronic
1133500899 16:6365433-6365455 TGAGTGAATGGATGGGTGGATGG + Intronic
1133950521 16:10387838-10387860 TGTGTGTGTGTCCGGGTGGCGGG - Intronic
1134106965 16:11492254-11492276 TGGGTGGGTGGCTGGCTGGCTGG - Intronic
1134106967 16:11492262-11492284 TGGGTGGGTGGGTGGGTGGCTGG - Intronic
1134224781 16:12381575-12381597 TGGATGAGTGAGTGGGTGGGTGG - Intronic
1134538716 16:15047253-15047275 TGAGTGAATGAGTGGGTGCTGGG - Intronic
1135074649 16:19383013-19383035 TAAGTGGCTGACTGGGAGGCTGG + Intergenic
1135078615 16:19415079-19415101 AGAGTGAGAAACTGGGTGGCTGG - Intronic
1135251979 16:20908009-20908031 TGAGTGAGTGGATGGATGGATGG + Intronic
1135661124 16:24297520-24297542 TGAGTGAGTGAGTGGGTGGGCGG - Intronic
1135661126 16:24297524-24297546 TGAGTGAGTGAGTGAGTGGGTGG - Intronic
1135681801 16:24463585-24463607 GGAGCGAGTGAATGGGAGGCTGG + Intergenic
1135893068 16:26374480-26374502 TGGGTGAGTGGATGGGTGGATGG + Intergenic
1135928849 16:26719358-26719380 TGAGTGAGTGAATGAGTGAGTGG + Intergenic
1136279090 16:29197578-29197600 TGCGTGAGTGAATGGGTGGGTGG + Intergenic
1136279097 16:29197613-29197635 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1136290998 16:29271228-29271250 TGAGTGGGTGAATGGATGGTTGG + Intergenic
1136295504 16:29299244-29299266 TGGATGAGTGAGTGGGTGGATGG + Intergenic
1136400736 16:30016708-30016730 TTACTGAATGACTGGGTGACTGG - Intronic
1137271692 16:46906593-46906615 TGAGTGAGTGGATGAGTGGATGG + Intronic
1137512342 16:49112595-49112617 TGAATGAGTGAATGGATGGATGG - Intergenic
1137561743 16:49506791-49506813 TGGATGAGTGGATGGGTGGCTGG + Intronic
1137601599 16:49760074-49760096 TGAGTGGATGAATGGGTGGATGG + Intronic
1137621287 16:49878063-49878085 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
1137671840 16:50283802-50283824 TGAGGGAGTGACAGGGAGGCAGG + Intronic
1138547598 16:57729055-57729077 TGGGTGAGTGAGTGAGTGGATGG + Intronic
1138547655 16:57729291-57729313 TGGATGAGTGAGTGGGTGGATGG + Intronic
1138547656 16:57729295-57729317 TGAGTGAGTGGGTGGATGGATGG + Intronic
1138547667 16:57729351-57729373 TGAGTGAGTGAGTGGGCAGATGG + Intronic
1138547694 16:57729455-57729477 TGGATGAGTGAGTGGGTGGGTGG + Intronic
1138547695 16:57729459-57729481 TGAGTGAGTGGGTGGGTGGATGG + Intronic
1138547716 16:57729531-57729553 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1138547717 16:57729535-57729557 TGAGTGAGTGGGTGGGTGGATGG + Intronic
1138547737 16:57729603-57729625 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1138547738 16:57729607-57729629 TGAGTGAGTGGGTGGGTGGATGG + Intronic
1138547776 16:57729739-57729761 TGAGTGAGTGAGCAGGTGGGTGG + Intronic
1138547785 16:57729767-57729789 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1138547794 16:57729803-57729825 TGAGTGAGTAGGTGGGTGGATGG + Intronic
1138547816 16:57729895-57729917 TGAGTGAGTGAGTAGGTGGGTGG + Intronic
1138547817 16:57729899-57729921 TGAGTGAGTAGGTGGGTGGATGG + Intronic
1138547867 16:57730098-57730120 TGAGTGAGTGAGCGGGTGGGTGG + Intronic
1138547868 16:57730102-57730124 TGAGTGAGCGGGTGGGTGGATGG + Intronic
1138547876 16:57730126-57730148 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1138547904 16:57730250-57730272 TGAGTGAGTGAGTAGGTGGGTGG + Intronic
1138547905 16:57730254-57730276 TGAGTGAGTAGGTGGGTGGATGG + Intronic
1138583303 16:57955421-57955443 TGAGTGAGTGAGTGAGTGAGTGG + Intronic
1138975543 16:62202827-62202849 TGTGTGTGTGTCTGGGTGGAAGG + Intergenic
1139257743 16:65559232-65559254 TGTGTGTGTGACAGGGTGACAGG + Intergenic
1139263712 16:65620549-65620571 TGAGGGAGAGACTTGGTGGGAGG - Intergenic
1140067670 16:71625324-71625346 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1140067671 16:71625328-71625350 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
1140067678 16:71625352-71625374 TGGATGAGTGAATGGGTGGGTGG + Intergenic
1140067679 16:71625356-71625378 TGAGTGAATGGGTGGGTGGATGG + Intergenic
1140067701 16:71625437-71625459 TGAGTGGGTGAGTGGGCGGATGG + Intergenic
1140067714 16:71625476-71625498 TGGGTGGGTGAGTGGGTGGATGG + Intergenic
1140067717 16:71625484-71625506 TGAGTGGGTGGATGGGTGGATGG + Intergenic
1140067769 16:71625666-71625688 TGAGTGGTTGAATGGGTGGATGG + Intergenic
1140067781 16:71625702-71625724 TGAGTGGGTGGATGGGTGGATGG + Intergenic
1140067791 16:71625733-71625755 TGGGTGGGTGAGTGGGTGGATGG + Intergenic
1140067798 16:71625753-71625775 TGGGTGGGTGAGTGGGTGGATGG + Intergenic
1140456856 16:75110813-75110835 AGAGTGGGTGGCTGGCTGGCTGG + Exonic
1140684204 16:77417287-77417309 TGAGTGGGTGTGTGGGTGGATGG + Intronic
1140716641 16:77732439-77732461 TGAGTCAGTGAATGAGTGGGTGG - Intronic
1140853243 16:78954250-78954272 TGGTTGAGTGAGTGGGTGGATGG + Intronic
1140913498 16:79474410-79474432 TGAGCAAGTGCCTGGCTGGCTGG + Intergenic
1141042880 16:80687363-80687385 TGAGTGCGTGGGTGGGTGGATGG + Intronic
1141045961 16:80716391-80716413 TGAATGAGTGGGTGGGTGGATGG + Intronic
1141048868 16:80742735-80742757 TGGGTGAGTGAGTGGGTGGATGG + Intronic
1141096781 16:81168516-81168538 TGAATGAATGAATGGGTGGATGG + Intergenic
1141178345 16:81735251-81735273 TGAGTGAGTGGGTGGATGGGTGG + Intergenic
1141178351 16:81735283-81735305 TGAGTGGATGACTGGGTGGATGG + Intergenic
1141308054 16:82885435-82885457 TGAATGAATGAGTGGGTGGGGGG - Intronic
1141420807 16:83914321-83914343 TGAGTGAGCGACTAGCTGCCCGG - Intronic
1141650025 16:85387973-85387995 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650047 16:85388057-85388079 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650068 16:85388153-85388175 TGAATGGGTGAGTGGGTGGATGG + Intergenic
1141650072 16:85388161-85388183 TGAGTGGGTGGATGGGTGGGTGG + Intergenic
1141650100 16:85388273-85388295 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650147 16:85388461-85388483 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650175 16:85388569-85388591 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141690900 16:85595736-85595758 TGAGTGAATGGCTGGGTGTGGGG - Intergenic
1141878820 16:86844770-86844792 GGAGTGAGTGGCCGGGTGGCAGG + Intergenic
1141904400 16:87014243-87014265 TGAGTGAGTGAATGACTGGGTGG - Intergenic
1141943466 16:87294063-87294085 TGAATGAGTGGCTGGGTGAATGG + Intronic
1141943480 16:87294111-87294133 TGGGTGGGTGAGTGGGTGGATGG + Intronic
1141994605 16:87628407-87628429 TGAGTGAGTGAGGGAGGGGCCGG + Intronic
1142083490 16:88163706-88163728 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1142101375 16:88273130-88273152 TGGATGAGTGAGTGGGTGGATGG + Intergenic
1142104205 16:88293394-88293416 TGAATAATTGACTGGGTGGATGG + Intergenic
1142124152 16:88401885-88401907 TGAGTGGGTGAGTGGATGGATGG + Intergenic
1142128652 16:88422378-88422400 TGAATGGGTGAATGGGTGGGTGG + Intergenic
1142214874 16:88825374-88825396 TGGCTGGGTGTCTGGGTGGCCGG + Intronic
1142248314 16:88979750-88979772 TGGATGAGTGAATGGGTGGATGG + Intergenic
1142248327 16:88979806-88979828 TGGGTGAGTGAGTGAGTGGGTGG + Intergenic
1142248328 16:88979810-88979832 TGAGTGAGTGAGTGGGTGGATGG + Intergenic
1142248330 16:88979814-88979836 TGAGTGAGTGGGTGGATGGGTGG + Intergenic
1142248332 16:88979818-88979840 TGAGTGGGTGGATGGGTGGGTGG + Intergenic
1142255308 16:89011125-89011147 TGAGTGCGTGGGTGGGTGGATGG - Intergenic
1142255309 16:89011129-89011151 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255334 16:89011233-89011255 TGAGTGCGTGGGTGGGTGGATGG - Intergenic
1142255344 16:89011277-89011299 TGAGTGCGTGGGTGGGTGGATGG - Intergenic
1142255345 16:89011281-89011303 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255362 16:89011349-89011371 TGAGTGTGTGGGTGGGTGGATGG - Intergenic
1142255363 16:89011353-89011375 TGGGTGAGTGTGTGGGTGGGTGG - Intergenic
1142255381 16:89011421-89011443 TGAGTGCGTGGGTGGGTGGATGG - Intergenic
1142255390 16:89011457-89011479 TGAGTGCGTGGGTGGGTGGATGG - Intergenic
1142255391 16:89011461-89011483 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255409 16:89011529-89011551 TGAGTGTGTGGGTGGGTGGATGG - Intergenic
1142255410 16:89011533-89011555 TGGGTGAGTGTGTGGGTGGGTGG - Intergenic
1142255419 16:89011565-89011587 TGAGTGTGTGGGTGGGTGGATGG - Intergenic
1142255436 16:89011637-89011659 TGAGTGCGTGGGTGGGTGGATGG - Intergenic
1142255437 16:89011641-89011663 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255446 16:89011673-89011695 TGAGTGCGTGGGTGGGTGGATGG - Intergenic
1142255455 16:89011709-89011731 TGAGTGCGTGGGTGGGTGGATGG - Intergenic
1142255473 16:89011781-89011803 TGAGTGTGTGGGTGGGTGGATGG - Intergenic
1142255486 16:89011852-89011874 TGAGTGCGTGGGTGGGTGGATGG - Intergenic
1142255593 16:89012295-89012317 TGGGTGGGTGAATGGGTGGATGG - Intergenic
1142255626 16:89012422-89012444 TGGGTGGGTGAATGGGTGGATGG - Intergenic
1142639158 17:1275586-1275608 TGAGTGTGTGAGTGTGTGGGGGG + Intergenic
1142843362 17:2651727-2651749 GGAGTGAGTGACTTGGTAGAGGG + Intronic
1143301250 17:5912141-5912163 TGAGTGGGTGGATGGGTGGATGG - Intronic
1143474581 17:7195415-7195437 GGAGCCAGTGTCTGGGTGGCTGG + Intronic
1143535775 17:7538444-7538466 TGAGTCAGTTTCTGGGTGGGGGG + Intergenic
1143544676 17:7589124-7589146 TGGGTGAGTGCCTGGGAAGCGGG - Exonic
1143682560 17:8488194-8488216 AGAGTGAGTGAGTGGCTGACAGG - Intronic
1143739972 17:8945348-8945370 TGAGTGTGTGTGTGTGTGGCTGG - Intronic
1143780882 17:9228919-9228941 TGCGTGTGTGACTGGGTGTGTGG + Intronic
1144241772 17:13319726-13319748 AGACTGAGTGCCTGGGTGGGAGG - Intergenic
1144666583 17:17106232-17106254 TGAGTGACTGAATGGGTGAAAGG + Intronic
1144773639 17:17772996-17773018 TGAGTGAGTGGATGGGTGGATGG + Intronic
1144969072 17:19095745-19095767 TGTCTGAGAGAGTGGGTGGCTGG + Intronic
1144978844 17:19156321-19156343 TGTCTGAGAGAGTGGGTGGCTGG - Intronic
1144989378 17:19221911-19221933 TGTCTGAGAGAGTGGGTGGCTGG + Intronic
1145240021 17:21235739-21235761 TGAGTGGATGGCTGGCTGGCTGG - Intergenic
1145240037 17:21235803-21235825 TGAATGGGTGAATGGATGGCTGG - Intergenic
1145240080 17:21235961-21235983 TGAGTGAGTGGGTGGATGGATGG - Intergenic
1145240081 17:21235965-21235987 TGCATGAGTGAGTGGGTGGATGG - Intergenic
1145240092 17:21236025-21236047 TGAGTGGGTGGATGGGTGGGTGG - Intergenic
1145240094 17:21236029-21236051 TGAGTGAGTGGGTGGATGGGTGG - Intergenic
1145240096 17:21236033-21236055 TGGATGAGTGAGTGGGTGGATGG - Intergenic
1145240105 17:21236077-21236099 TGAGTGGATGAGTGGGTGGATGG - Intergenic
1145240183 17:21236417-21236439 TGGGTGAATGGCTGGGTGGATGG - Intergenic
1145271549 17:21407483-21407505 TGGGTGAGTGAATGAGTGGATGG - Intronic
1145271590 17:21407647-21407669 TGGGTGGGTGACTGAGTGGATGG - Intronic
1145309763 17:21694931-21694953 TGGGTGAGTGAATGAGTGGATGG - Intronic
1145778589 17:27546636-27546658 TGAGTGCGTGCCTGGTGGGCAGG + Intronic
1146370802 17:32264933-32264955 CTAGTGAGTGAGTGGGTGGTGGG + Intergenic
1146478436 17:33181896-33181918 AGAGTGAGGGAGTGTGTGGCAGG + Intronic
1146504749 17:33395144-33395166 TGGGTGGGTGAGTGGGTGGGGGG - Intronic
1146809988 17:35895497-35895519 TGAGTGGGTGGGTGGGTGACTGG - Intergenic
1148346076 17:46904371-46904393 TGGGTGGCTGACTGGCTGGCTGG + Intergenic
1148346090 17:46904419-46904441 TGCGTGGGTGGCTGGGTGGCTGG + Intergenic
1148648724 17:49234328-49234350 TGAGTCAGTTCCTGGGTGGGGGG + Intergenic
1148904943 17:50905931-50905953 TGAGTGTGTGTGTGTGTGGCGGG - Intergenic
1148908682 17:50928058-50928080 TGAGTGAGTGGATGGGTGGATGG - Intergenic
1148908683 17:50928062-50928084 TGAATGAGTGAGTGGATGGGTGG - Intergenic
1148989097 17:51649993-51650015 TGGGTGGGTGGCTGGCTGGCTGG - Intronic
1149023343 17:51995982-51996004 TGAGTGAATGCATGGATGGCAGG - Intronic
1149418301 17:56483339-56483361 AGGGTGAGTGAGTGGGTGGGTGG + Intronic
1149814770 17:59713068-59713090 GGATTTAGTGACTGGGTGGGTGG + Intronic
1149983021 17:61326320-61326342 TGAAAGAGGGCCTGGGTGGCTGG + Intronic
1151040916 17:70860395-70860417 TGAGTGAGGGACCTGGTGGGAGG - Intergenic
1151307028 17:73269291-73269313 TGAGTGAGTGAATGAGTGAATGG - Intergenic
1151571013 17:74925323-74925345 TGAGTGTATGACTGAGTGGGTGG - Intronic
1151752811 17:76050617-76050639 TGCGTGAGTGAGTGTGTGGTTGG - Intronic
1151973213 17:77469769-77469791 TGAGTGAGTGGATGGGTGGGTGG - Intronic
1151973215 17:77469773-77469795 TGGGTGAGTGAGTGGATGGGTGG - Intronic
1151973279 17:77470095-77470117 TGAGTGAATGAGTGGATGGGTGG - Intronic
1151973386 17:77470674-77470696 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1151973387 17:77470678-77470700 TGAATGGGTGAGTGGGTGGGTGG - Intronic
1151987853 17:77555726-77555748 TAAGGGAGGGGCTGGGTGGCAGG - Intergenic
1152068421 17:78123762-78123784 TGAGTGGGTGGATGGGTGGGTGG + Intronic
1152088256 17:78233006-78233028 TGAGTGAGTGCATGTGTGGGTGG + Intronic
1152133241 17:78489840-78489862 TGGGTGAGTGGGTGGGTGGGCGG + Intronic
1152141621 17:78540476-78540498 TGTGTGAGTGGGTGGGTGGATGG + Intronic
1152141631 17:78540500-78540522 TGGGTGGGTGACTGGGTGGGTGG + Intronic
1152141637 17:78540520-78540542 TGGGTGAGTGGATGGGTGGATGG + Intronic
1152141688 17:78540736-78540758 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1152141906 17:78541304-78541326 TGGGTGAGTGAGTGGATGGGTGG + Intronic
1152301788 17:79499128-79499150 TGAGTGAATGGATGGGTGGGTGG - Intronic
1152367134 17:79862842-79862864 TGAGTGAGGGGCTGGGTGGGAGG + Intergenic
1152484069 17:80578203-80578225 TGAGTGAGTGGTTGGGGGGGTGG + Intronic
1152767410 17:82148737-82148759 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1154082085 18:11267549-11267571 TGATTTAGTGACTGGATGACAGG + Intergenic
1154153299 18:11924697-11924719 TGAGTCAGTGAGTGAGTGGTGGG - Intergenic
1154307922 18:13243975-13243997 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
1155193266 18:23450195-23450217 TGATTGGTTGACTGGGTGGAAGG - Intergenic
1157299849 18:46471887-46471909 TGAATGAGTGGATGGGTGGATGG - Intergenic
1157299870 18:46471991-46472013 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
1157299873 18:46471999-46472021 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
1157299876 18:46472007-46472029 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
1157299879 18:46472015-46472037 TGAATGGGTGGCTGGGTGGCTGG - Intergenic
1157299882 18:46472023-46472045 TGGGTGGGTGAATGGGTGGCTGG - Intergenic
1157341721 18:46784720-46784742 TGAGTGAGGGACCTGGTGGGAGG - Intergenic
1157401595 18:47393075-47393097 TGAGGGAGGGAATGGGTGGAGGG + Intergenic
1157518595 18:48328995-48329017 TGAGTGGGTAAATGGATGGCTGG + Intronic
1157559356 18:48635819-48635841 TGGGTGACTGGCTGGGAGGCTGG - Intronic
1157601392 18:48895153-48895175 TGAATGAGTGGCTGAGTGCCTGG + Intergenic
1158023640 18:52870692-52870714 TGAGTCAGTTGCTGGGTGGGGGG - Intronic
1158184332 18:54754115-54754137 TGAGGGAGAGACCGGGTGGGAGG + Intronic
1158400048 18:57113814-57113836 TGAGTGGGTGGATGGATGGCTGG - Intergenic
1159006900 18:63021419-63021441 TGGTTGACTGACTGGCTGGCTGG - Intergenic
1160310931 18:77789377-77789399 TGTGTGGGTGATAGGGTGGCTGG - Intergenic
1160681801 19:415076-415098 TGAATGGGTGACTGGATGGATGG + Intergenic
1160687220 19:442616-442638 TGGATGAGTGAATGGGTGGATGG + Intronic
1160831210 19:1105620-1105642 TGTGTGAGTGAGTCGGGGGCTGG - Intronic
1160958393 19:1705894-1705916 TGGATGAGTGGGTGGGTGGCTGG + Intergenic
1160960225 19:1717654-1717676 TGGGTGAGTGAGTGGATGGATGG + Intergenic
1160960395 19:1718298-1718320 TGGGTGAGTGGGTGGGTGGTGGG + Intergenic
1160977726 19:1802113-1802135 TGAGTGGGGGAGTGGGTGGATGG - Intronic
1161090403 19:2357315-2357337 TGGGTGTGTGGATGGGTGGCTGG - Intergenic
1161090547 19:2357890-2357912 TGAGTGGGTGGGTGGGTGGAAGG - Intergenic
1161131262 19:2590437-2590459 TGAGTGAATGGATGGGTGGATGG - Intronic
1161227666 19:3154617-3154639 TGAGTGAATGGCTGGATGGGTGG + Intronic
1161227686 19:3154704-3154726 TGAGTGAATGGCTGGATGGGTGG + Intronic
1161258476 19:3322700-3322722 TGAGTGAGTGAATGGATGAGTGG + Intergenic
1161287371 19:3475789-3475811 TGAGTGAGTGTGTGGGTGGGCGG + Intronic
1161287760 19:3477623-3477645 TGAGTGGGTGAATGGGTGAGTGG + Intronic
1161287763 19:3477631-3477653 TGAATGGGTGAGTGGGTGGATGG + Intronic
1161287791 19:3477730-3477752 TGAGTGGGTGAATGGGTGAGTGG + Intronic
1161287794 19:3477738-3477760 TGAATGGGTGAGTGGGTGGATGG + Intronic
1161287800 19:3477762-3477784 TGAGTGGGTGAATGGGTGAGTGG + Intronic
1161287814 19:3477820-3477842 TGAGTGGGTGAATGGGTGAGTGG + Intronic
1161297846 19:3528612-3528634 TGAGAGAGTGAATGAGTGGATGG + Intronic
1161372921 19:3923761-3923783 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1161372925 19:3923785-3923807 TGAGTGAGTGACTGGATGGGTGG + Intronic
1161373015 19:3924157-3924179 TGAGTGAGTGGCTGGATGGGTGG + Intronic
1161373027 19:3924218-3924240 TGGGTGAGTGAGTGTGTGGATGG + Intronic
1161373028 19:3924222-3924244 TGAGTGAGTGTGTGGATGGATGG + Intronic
1161857963 19:6776560-6776582 TGAGTGGGTGAATGAGTGGGTGG - Intronic
1161974358 19:7600227-7600249 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
1161974499 19:7600646-7600668 TGAGTGGATGAGTGGGTGGGTGG - Intronic
1162056902 19:8069994-8070016 AGAGTGAGTGAGTGGTTGTCAGG - Intronic
1162156601 19:8682588-8682610 TGAGTGAATGAGTGGGTGAATGG - Intergenic
1162197215 19:8994257-8994279 TGAATGAGTGACTGAGGGTCTGG - Intergenic
1162321269 19:9972069-9972091 TGAGTGAGTGAATGAGTGAATGG - Intronic
1162321292 19:9972457-9972479 TGAATGAATGAATGGGTGGATGG - Intronic
1162388836 19:10377505-10377527 TGAGTGGGTGAGTGGGTGGGTGG + Intronic
1162388837 19:10377509-10377531 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1162388981 19:10377959-10377981 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1162389029 19:10378099-10378121 TGAGTGGGTGGATGGGTGGGTGG + Intronic
1162956838 19:14103443-14103465 TCAGTGAGAGACTGGGTGCCAGG - Intronic
1163017791 19:14467432-14467454 TGAGTGAGGGGCTGCGTGGGAGG + Intronic
1163050813 19:14682385-14682407 TGAGTGTGTGACTAAGTGGATGG - Intronic
1163404291 19:17112820-17112842 TGGGTGAGTGCCTGGCTGGGAGG - Intronic
1163493943 19:17633745-17633767 TGAGTGAATGAGTGGATGGAGGG - Intronic
1163493945 19:17633749-17633771 TGAATGAGTGAATGAGTGGATGG - Intronic
1163703704 19:18800139-18800161 TGAATGAATGAATGGGTGGATGG + Intergenic
1163811217 19:19432993-19433015 TTCCTGAGTGACTGGGTGGTGGG + Intronic
1164492498 19:28727644-28727666 GAAGTGCCTGACTGGGTGGCCGG - Intergenic
1164621057 19:29696336-29696358 TGTTTGAGTGTCTGGGTGTCTGG - Intergenic
1164621450 19:29698026-29698048 TGACAGAGTGTCTGGGTGGTGGG - Intergenic
1164716319 19:30393139-30393161 TGAGTGAATGAATGAGTGGATGG - Intronic
1164797443 19:31045346-31045368 TGAGTGAGTGATTGAGTGGTAGG + Intergenic
1164802564 19:31089817-31089839 AGAGTAAGTGACTAGTTGGCGGG - Intergenic
1165443071 19:35841994-35842016 TGAGTGAGTGAATGGTTGAGTGG - Intronic
1166321019 19:42018964-42018986 TGAATGAGTGAATGTGTGGGAGG + Intronic
1166375249 19:42324135-42324157 TCAGGGAAGGACTGGGTGGCGGG - Intronic
1166470378 19:43074864-43074886 TGGGTGAGTGTCTGTGAGGCAGG + Intronic
1166750949 19:45163819-45163841 TGTGTGTGTGCCTGGGAGGCAGG - Intronic
1166948816 19:46413079-46413101 TGAGGGAGGGACTGGATGGGGGG + Exonic
1167061073 19:47146813-47146835 GGCTTGAGTGACTGGGTGGGTGG + Intronic
1167061074 19:47146817-47146839 TGAGTGACTGGGTGGGTGGCTGG + Intronic
1167101373 19:47406231-47406253 TGGGTGAGTGAGTGGGTAGATGG + Intronic
1167146766 19:47685516-47685538 TGGGTGTGTGACTGGGTGATTGG + Intronic
1167166149 19:47801956-47801978 TGAGGGAATAACTGGGTGTCTGG + Exonic
1167230406 19:48279485-48279507 TGAGTGTGTGTGTGGGTGGGGGG + Intronic
1167601253 19:50456137-50456159 TGAGTGGGTGGGTGGGTGGATGG - Intronic
1168086886 19:54054710-54054732 TGAGTGGATGAATGGGTGGAAGG + Intronic
1168471994 19:56647500-56647522 TGAGTGAGTGGCCAGATGGCAGG - Intronic
1168711390 19:58502129-58502151 TGAGTGAGTAGATGGGTGGGTGG + Intronic
1168711411 19:58502336-58502358 TGAGTGAGTGGATGGATGGGTGG + Intronic
1168711431 19:58502544-58502566 TGAGTGAGTGGATGGATGGGTGG + Intronic
1168711455 19:58502788-58502810 TGAGTGAGTAGATGGATGGCTGG + Intronic
1168711462 19:58502860-58502882 TGAGTGAGTAGATGGATGGCTGG + Intronic
1202697756 1_KI270712v1_random:137463-137485 TGATTGAATGATTGGGTGGATGG + Intergenic
924966402 2:80493-80515 TGAGTGTGTGACTTGCTGGCTGG + Intergenic
925130871 2:1493193-1493215 TGTGTGTGTGAGTGGGTGGGGGG + Intronic
925263750 2:2549950-2549972 TGGATGAGTGGCTGGCTGGCTGG + Intergenic
925263751 2:2549954-2549976 TGAGTGGCTGGCTGGCTGGCTGG + Intergenic
925347765 2:3182917-3182939 TGAGTGGGTGGCTGGATGGGTGG - Intergenic
925347843 2:3183189-3183211 TGGGTGAGTGGATGGGTGGATGG - Intergenic
925347861 2:3183245-3183267 TGGGTGAGTGGGTGGATGGCGGG - Intergenic
925745304 2:7038851-7038873 TGAGTGGGTGAATGGGTGGATGG + Intronic
926672754 2:15591284-15591306 AGAGTGAGTGTCTGGTTGGGAGG + Exonic
926951835 2:18251757-18251779 TGAGGGAGTGACCTGGTGGGAGG - Intronic
927809900 2:26175063-26175085 TGTGTGTGTGGCAGGGTGGCGGG - Intronic
928083212 2:28328006-28328028 TGAGTGAGTGACTGGCACGATGG - Intronic
928127886 2:28628732-28628754 TGAGTGAGCACCTGGATGGCAGG + Intronic
928296513 2:30088769-30088791 TGAGTCAGTTCCTGGGTGGGGGG - Intergenic
929606754 2:43239852-43239874 TGAATGGGTGAGTGGGTGGATGG - Intronic
930003752 2:46879849-46879871 TGAGTAGGTGAGTGGGTGGATGG + Intergenic
931496200 2:62809641-62809663 TGGGGGAGTGACAGGGTGGTAGG - Intronic
931904878 2:66831615-66831637 TGAGGGAGAGACTTGGTGGGAGG + Intergenic
931963743 2:67510065-67510087 TGGGTGAGTCAGTGGGTGACGGG - Intergenic
932416923 2:71579130-71579152 GGAGGGGGTGACTGGGTGGGAGG - Intronic
933759949 2:85666240-85666262 TGTGTGTGTGTCTGGCTGGCTGG + Intronic
933759989 2:85666512-85666534 TGTGTGTGTGTCTGGCTGGCTGG + Intronic
933962435 2:87414524-87414546 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
933963160 2:87417720-87417742 TGGGTGGCTGGCTGGGTGGCTGG - Intergenic
934269602 2:91525709-91525731 TGGCTGGGTGGCTGGGTGGCTGG + Intergenic
934278927 2:91594459-91594481 TGATTGAATGATTGGGTGGATGG + Intergenic
934523966 2:95039389-95039411 TGAGTGAGTGACTGAGTGAATGG + Intronic
934523968 2:95039441-95039463 TGAGTGAGTGAGTGAGTGAGTGG + Intronic
934523977 2:95039569-95039591 TGAGTCAGTGACTGAGTGGGTGG + Intronic
934621844 2:95815041-95815063 TGAGTGACTGACTGGATGTGTGG - Intergenic
934768588 2:96894343-96894365 TGGGTGAGTGGGTGGGTGTCAGG - Intronic
934780808 2:96968557-96968579 TCAGTGAGTGGCTGGCTAGCAGG - Intronic
934811600 2:97283772-97283794 TGAGTGACTGACTGGATGTGTGG + Intergenic
934826091 2:97424168-97424190 TGAGTGACTGACTGGATGTGTGG - Intergenic
935292251 2:101620552-101620574 AGAGTGACTGAGAGGGTGGCTGG - Intergenic
935432755 2:102993911-102993933 TGAGCCAGTCAGTGGGTGGCAGG - Intergenic
935683401 2:105659154-105659176 TGAGGGAGTGACCTGGTGGGGGG - Intergenic
935855804 2:107271648-107271670 TGAGAGAGGGACCGGGTGGAAGG + Intergenic
936405555 2:112199489-112199511 TGTGTGAGTGAGTGGGTGTTAGG - Intergenic
936834407 2:116689806-116689828 TGAGTGAGTGAGTGAGTGAGTGG + Intergenic
937085484 2:119169077-119169099 TGGCTGAGTGGCTGGGGGGCTGG - Intergenic
937234146 2:120420181-120420203 TGGGTGGGTAACTGGATGGCTGG - Intergenic
937316978 2:120937889-120937911 TGAGAAAGGGCCTGGGTGGCCGG - Intronic
937320688 2:120958950-120958972 TGAGTGAGTGAATGAGTGAATGG + Intronic
937383429 2:121403359-121403381 TGGGTGAATGAATGGGTGGATGG + Intronic
937956709 2:127425901-127425923 TGACTGACTGACTGGCTGACTGG + Intronic
937970749 2:127546908-127546930 TGAGTGGGTGAATGGGTGGGTGG - Intronic
937977081 2:127588820-127588842 TGGGTGAGTGGATGGGTGGATGG + Intronic
937977127 2:127588997-127589019 TGGGTGAGTGAGTGGATGGGTGG + Intronic
937977129 2:127589001-127589023 TGAGTGAGTGGATGGGTGGTGGG + Intronic
937977142 2:127589040-127589062 TGGGTGAGTGGATGGGTGGATGG + Intronic
937977371 2:127589834-127589856 TGAGTGGGTGGATGGGTGGTGGG + Intronic
938108218 2:128547482-128547504 TGAGTGGGTGAATGGATGGATGG - Intergenic
938188613 2:129255025-129255047 TGAGTGGGTGTCTAGGTGGAGGG - Intergenic
938188646 2:129255185-129255207 TGAGTGGGTGTCTAGGTGGGTGG - Intergenic
938188678 2:129255325-129255347 TGAGTGGGTGTCTAGGTGGGTGG - Intergenic
938188712 2:129255490-129255512 TGAGTGGGTGTCTAGGTGGGTGG - Intergenic
938188847 2:129256207-129256229 TGAGTGAGTGTCTAGGTAGATGG - Intergenic
938540397 2:132280167-132280189 TGATTGGGTCAGTGGGTGGCAGG - Intergenic
938730205 2:134141501-134141523 TGGGTGGGTGGGTGGGTGGCTGG + Intronic
939358340 2:141134057-141134079 TGTGTGAGTGACTGAGTGCATGG - Intronic
942244499 2:173994683-173994705 TGAATGAATGAATGGGTGGATGG + Intergenic
942325526 2:174773185-174773207 TGAGAAAGTGTCTGGGTGTCTGG + Intergenic
942378790 2:175365220-175365242 TGAGTGTGTGACTGGGGTGGGGG - Intergenic
942894579 2:181036574-181036596 TGAGTGAGTGAGGGGGTGTGGGG + Intronic
942957002 2:181785090-181785112 TGAGTGTATTACTGGGAGGCAGG + Intergenic
943225851 2:185174839-185174861 TGTGTGTGTGACATGGTGGCAGG + Intergenic
944492004 2:200267434-200267456 AGAATGAGTGAGTGGGTAGCGGG - Intergenic
944808999 2:203309517-203309539 TGTGGGAGGGACTGGGTGGTGGG + Intergenic
944831197 2:203535283-203535305 TGACTGACTGACTGACTGGCGGG + Exonic
945102410 2:206274576-206274598 AGAGTGAGTGAGTGGGTGGGCGG + Intergenic
945114073 2:206393711-206393733 TGTGGGAGGGACTGGGTGGGAGG + Intergenic
946823829 2:223656345-223656367 TCAGTGATTGTCTGGGTGGCAGG + Intergenic
947520803 2:230844643-230844665 TGAATGAATGGCTGGCTGGCTGG - Intergenic
947631913 2:231659157-231659179 TGAATGAGTGATTTGGTGTCTGG - Intergenic
947980832 2:234408234-234408256 TGAGTGGGTGAATGAGTGACTGG - Intergenic
948089611 2:235281866-235281888 TGAGGGAGAGACTTGGTGGGAGG + Intergenic
948180777 2:235978284-235978306 TGCGTGGGTGAGTGGGTGGGTGG - Intronic
948274407 2:236697056-236697078 TGAGTGTGTGTGTGGGTGGGTGG + Intergenic
948330117 2:237157903-237157925 TGAGTGAGTGAGTGAGGGGCTGG - Intergenic
948366394 2:237457694-237457716 TGAGTGGGTGAATGGGTGGATGG + Intergenic
948366413 2:237457763-237457785 TGGGTGGGTGAATGGGTGGATGG + Intergenic
948366416 2:237457771-237457793 TGAATGGGTGGATGGGTGGCTGG + Intergenic
948366419 2:237457779-237457801 TGGATGGGTGGCTGGGTGGCTGG + Intergenic
948366435 2:237457839-237457861 TGGGTGGGTGAATGGGTGGATGG + Intergenic
948531978 2:238614818-238614840 TGAGTGAATGAGTGGATGGATGG - Intergenic
948636758 2:239343336-239343358 TGAAGGAGTGACTGGGTGATTGG - Intronic
948700200 2:239754872-239754894 TGAGTGAGTGGATGGATGGATGG + Intergenic
948735373 2:240000631-240000653 TGAGTCAGTGAGTGAGTGGTGGG - Intronic
948769243 2:240239733-240239755 TGAGTGGATGGCTGGATGGCTGG + Intergenic
948813768 2:240499435-240499457 TGTGGGAGTGACTAGGTGGGTGG + Intronic
948815588 2:240508773-240508795 TGAATGAATGAATGGGTGGACGG + Intronic
948815662 2:240509162-240509184 AGAGTGAGTGAATGGGTAGTTGG + Intronic
948815673 2:240509198-240509220 TGGGTGAGTGGATGGGTGGATGG + Intronic
948818792 2:240527844-240527866 TGGGTGGGTGATTGGGTGGGTGG + Intronic
1168756442 20:321708-321730 AGAGTGAGTGACTGGGACGGGGG - Intergenic
1168995539 20:2130076-2130098 GGCTTGAGTGACTGGGTGGTGGG + Intronic
1169267210 20:4174061-4174083 TGGCTGAGGGACTGGGTGGCTGG + Intronic
1169934412 20:10867352-10867374 TGAGTGGGTGAGTGGGTGGATGG - Intergenic
1171253346 20:23667476-23667498 TGAGTGAGGAACCGGCTGGCAGG + Intergenic
1171259821 20:23722730-23722752 TGAGTGAGGGACTGGCCGGCAGG + Intergenic
1171268897 20:23798261-23798283 TGAGTGAGGGACCGGCCGGCAGG + Intergenic
1171289606 20:23974636-23974658 TGAGTGAATGAATGGGTGAATGG - Intergenic
1171750357 20:29043269-29043291 TGAGTTCCTGACTAGGTGGCAGG + Intergenic
1172024935 20:31942105-31942127 TGAGTGAGTGTCTGGGAAGCAGG + Intronic
1172115567 20:32571669-32571691 GGAGAGAGTGCCTTGGTGGCTGG - Intronic
1172184012 20:33020253-33020275 TGGGTGGGAGGCTGGGTGGCTGG + Intronic
1172196273 20:33093681-33093703 TGAGTGAGTGGATAGGTGGATGG - Intronic
1172485533 20:35295862-35295884 TGCATGTGTGTCTGGGTGGCGGG + Intergenic
1172583298 20:36065058-36065080 TGACTGGCTGACTGGCTGGCTGG + Intergenic
1172779874 20:37430181-37430203 TGAGTGAGTGGGTGGATGGATGG - Intergenic
1172779875 20:37430185-37430207 TGGATGAGTGAGTGGGTGGATGG - Intergenic
1172779900 20:37430339-37430361 TGAGTGAGTGGGTGGGTGGATGG - Intergenic
1172779901 20:37430343-37430365 TGGATGAGTGAGTGGGTGGGTGG - Intergenic
1172939467 20:38644610-38644632 TGGGTGAGTGGGTGGGTGACGGG - Intronic
1172939509 20:38644774-38644796 TGGGTGAATGAGTGGGTGGATGG - Intronic
1173117647 20:40261146-40261168 TGAGTGAGTGAGTGAGTGAGTGG - Intergenic
1173177375 20:40774526-40774548 TGAGGGAGGGACTTGGTGGTAGG - Intergenic
1173266808 20:41491035-41491057 TGAGTGAGTGAGTGAGTGGTGGG + Intronic
1173441850 20:43084550-43084572 TGAGGGAGGGACCTGGTGGCAGG - Intronic
1173465020 20:43274002-43274024 TGAGTGGGTGAATGGGCGGATGG + Intergenic
1173582690 20:44158847-44158869 TGAGTGAATGGATGCGTGGCTGG + Intronic
1173615308 20:44399622-44399644 TGAATGAGTGAATGTGTGGGTGG - Intronic
1173964043 20:47098413-47098435 TGAGTGAGTGCCTGTGTCTCAGG - Intronic
1174270493 20:49364877-49364899 TGAGTGAGTGAATGTGTGACTGG - Exonic
1174289802 20:49500003-49500025 TGGCTGAGTGAGGGGGTGGCAGG - Intergenic
1174302360 20:49591967-49591989 TGAGTGGGTGAGTGGGTAGATGG - Intergenic
1174302403 20:49592204-49592226 TGGGTGGGTGAATGGATGGCTGG - Intergenic
1174302415 20:49592255-49592277 TGAGTGAGTAAATGAGTGGATGG - Intergenic
1174368698 20:50071855-50071877 TGAATGGGTGAATGGCTGGCTGG - Intergenic
1174429821 20:50459592-50459614 TTAGTGGATGACTGGGTGGGTGG + Intergenic
1174512095 20:51061119-51061141 TGAGTGGGTGGGTGGGTGGATGG - Intergenic
1174588608 20:51627536-51627558 GGAAGGAGTGACTGGGAGGCAGG + Intronic
1174734004 20:52946890-52946912 TTAGTGAGTGACTGACAGGCGGG + Intergenic
1175119336 20:56706312-56706334 TGAGTGAATGAATGGATGGACGG - Intergenic
1175302395 20:57952227-57952249 TGGGTGTGTGAATGGGTGGATGG - Intergenic
1175375308 20:58519947-58519969 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1175375323 20:58520011-58520033 TGGGTGAGTGGATGGGTGGATGG + Intergenic
1175375382 20:58520238-58520260 TGAATGGGTGAATGGGTGGGTGG + Intergenic
1175407440 20:58744222-58744244 TGAGTGGGTGGATGGGTGGGTGG + Intergenic
1175485262 20:59341535-59341557 TGTGTGTGTGACTGTGTGGGTGG + Intergenic
1175493249 20:59393471-59393493 TGACTGAATGAATGGGTGGAAGG - Intergenic
1175526632 20:59638882-59638904 TGGGTGAGTGGATGGGTGGATGG + Intronic
1175772529 20:61632713-61632735 TGAATGAGTGAGTGGCTGGTTGG - Intronic
1175817286 20:61889879-61889901 TGGGTGAGTGAATGGATGGATGG + Intronic
1175818030 20:61893679-61893701 TGAGTGGGTGAGTGGATGGATGG + Intronic
1175901170 20:62360430-62360452 TGGGTGAGTGGGTGGGTGGAGGG + Intronic
1175950395 20:62580557-62580579 TGAGTGAGGCACAGGGTTGCTGG - Intergenic
1175985585 20:62762798-62762820 TGAATGAATGAGTGGGTGGGTGG - Intergenic
1176047169 20:63098863-63098885 TGAATGAATGAGTGGGTGGATGG + Intergenic
1176047185 20:63098984-63099006 TGAATGAATGAGTGGGTGGATGG + Intergenic
1176057837 20:63158222-63158244 TAGGTGAATGACTGGGTGGGTGG + Intergenic
1176314855 21:5232648-5232670 TGAGTTCCTGACTAGGTGGCAGG - Intergenic
1176372973 21:6073671-6073693 TGAGTGAGTCCCTTTGTGGCTGG + Intergenic
1177041292 21:16114581-16114603 TGTGTGAGGGACTTGGTGGGAGG - Intergenic
1177522841 21:22251955-22251977 TGTGTGAGTGTGTGGGTGGATGG + Intergenic
1178893534 21:36540651-36540673 GGAGGGAGGGACTGGGGGGCAGG + Intronic
1179680595 21:43018466-43018488 TGTGTGTGTGTGTGGGTGGCAGG - Intronic
1179750504 21:43464572-43464594 TGAGTGAGTCCCTTTGTGGCTGG - Intergenic
1179797286 21:43792576-43792598 TGAGTGAGTGAGTGGGTGAGTGG + Intronic
1179797288 21:43792580-43792602 TGAGTGAGTGGGTGAGTGGGTGG + Intronic
1179948548 21:44696975-44696997 TGAGTGAGTGTCTGGGTGCTAGG - Intronic
1180025148 21:45156555-45156577 TGAGTGGGTGCATGGGTGGATGG - Intronic
1180025156 21:45156603-45156625 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1180086007 21:45508203-45508225 TGAGTGTATGAATGGGTGGGTGG + Intronic
1180086046 21:45508355-45508377 TGGGTGAGTGGATGGGTGGATGG + Intronic
1180086058 21:45508409-45508431 TGAGTGGATGAATGGGTGGATGG + Intronic
1180086068 21:45508444-45508466 TGGGTGAGTGGATGGGTGGATGG + Intronic
1180086077 21:45508472-45508494 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1180167769 21:46038892-46038914 TGAGTGAGTGACGAGGCTGCTGG + Intergenic
1180182485 21:46124199-46124221 TTAGTGGGTGGCTGGGTGGATGG + Intronic
1180182492 21:46124226-46124248 TGGATGGGTGACTGGGTGGATGG + Intronic
1180485862 22:15796407-15796429 TGAGAGAGTGAGGGGGAGGCAGG - Intergenic
1180591823 22:16945030-16945052 TGAGTGAGTGACTGTGATTCAGG - Intergenic
1180854374 22:19036911-19036933 TGTGTGCGGGACAGGGTGGCTGG - Exonic
1181441525 22:22938332-22938354 TGGGTGGGTGAGTGGATGGCTGG + Intergenic
1181516355 22:23415758-23415780 CAAGTGAGTGACTGGGTTGGAGG - Intergenic
1181580058 22:23823193-23823215 TGTGTTAGTGACTGAATGGCAGG + Intronic
1181822583 22:25487427-25487449 AGAGTGGGTGAGTGGGTGGATGG + Intergenic
1181870460 22:25894299-25894321 TGAGTGTGTGAATGGATGGATGG + Intronic
1182009418 22:26987752-26987774 TGGGTGAGTGGATGGGTGGATGG + Intergenic
1182013302 22:27018498-27018520 TGAGTGAGTGAGTGGGTGAGTGG - Intergenic
1182060664 22:27394877-27394899 TGAGTGAGTGAGTGGTTGGATGG + Intergenic
1182086620 22:27565425-27565447 TGAGTGGGTGGATGGGTGGACGG + Intergenic
1182410685 22:30182917-30182939 TGGCTGAGGGACTGGGTGGGAGG - Intergenic
1183082219 22:35463724-35463746 TGAGTGAATGGATGGGTGGATGG - Intergenic
1183106527 22:35618944-35618966 TGAATGAGGGAATGGGTGGATGG - Intronic
1183332513 22:37229087-37229109 TGAGTGGGTGGCTGGGTGCCAGG - Intronic
1183348006 22:37318601-37318623 GGAGTGAGTGGCTGGGTCTCTGG - Intergenic
1183387927 22:37525647-37525669 TGAGTGGGTGGTTGGGTGGGCGG - Intergenic
1183396841 22:37576576-37576598 TCTGTGAGTGTCTGTGTGGCGGG - Intronic
1183741201 22:39669578-39669600 TGAATGGGTGGCTGGCTGGCTGG + Intronic
1184123711 22:42471716-42471738 TGAGTGTGTGGATGGGTGGGTGG - Intergenic
1184231076 22:43158817-43158839 TGAGTGAGTGAGTGAGTGAAAGG + Intronic
1184276679 22:43412689-43412711 TGAGTGAGTGGATGGATGGATGG - Intronic
1184280259 22:43433447-43433469 TGAGTGAGTGAATGAGTGAATGG + Intronic
1184434296 22:44460682-44460704 TGGTTGAGTGACTGGATGGATGG - Intergenic
1184444639 22:44540035-44540057 TGGGTGGGTGAGTGGGTGGATGG + Intergenic
1184513150 22:44944760-44944782 TGAGTGAGTGAATGGGTGAATGG + Intronic
1184578410 22:45394079-45394101 TGAGAGGTTGAGTGGGTGGCTGG + Intronic
1184731121 22:46371719-46371741 TGAGTGAGTGGATGGATGGGTGG - Intronic
1184731138 22:46371796-46371818 TGAGTGAGTGGATGGATGGGTGG - Intronic
1184731257 22:46372308-46372330 TGAGTGAGTGGATGGATGGATGG - Intronic
1184731270 22:46372360-46372382 TGAGTGAGTGGATGGATGGATGG - Intronic
1184731276 22:46372385-46372407 TGAGTGAGTGGATGGGTAGATGG - Intronic
1184878072 22:47288168-47288190 TCAGTGAATGACTGGGTAGGTGG - Intergenic
1184975380 22:48057924-48057946 GGAGTCAGTGCCTGCGTGGCTGG + Intergenic
1184991065 22:48170381-48170403 TGGGTGAGTGAATGGGCGGATGG - Intergenic
1185165603 22:49260512-49260534 TGAGTGAGTGAATGGATGGATGG - Intergenic
1185211431 22:49572896-49572918 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1185211457 22:49572980-49573002 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1185211476 22:49573044-49573066 TGAATGGGTGGCTGGGTGGGTGG + Intronic
1185212560 22:49579128-49579150 TGGGGGAGGGACTGGGTGGGAGG - Intronic
949741250 3:7237138-7237160 TGACAGAGTGACTTGCTGGCAGG - Intronic
950107739 3:10398909-10398931 GGAGTGAGTCATAGGGTGGCCGG - Intronic
950122032 3:10488337-10488359 TGGGTGAGTGAATGGATGGATGG - Intronic
950203033 3:11057989-11058011 TGAGTGGGTGGGTGGGTGGATGG + Intergenic
950541265 3:13614682-13614704 TGGGTGAGTGAATGGGTGGATGG - Intronic
950541817 3:13617627-13617649 TGGGTGAATGAATGGGTGGGTGG - Intronic
950541872 3:13617792-13617814 TGAGTGAGTGGATGGGTGGGTGG - Intronic
950541874 3:13617796-13617818 TGGGTGAGTGAGTGGATGGGTGG - Intronic
950551603 3:13669525-13669547 TGAGTGGGTGGGTGGGTGGATGG - Intergenic
950655574 3:14434264-14434286 TAAGTGAGTGAGTTGGTGTCTGG + Intronic
950721131 3:14883418-14883440 TGAGTGGGTGAAAGGCTGGCTGG - Intronic
950750896 3:15127166-15127188 TGAGTGAGTGAGGGGGTGGAGGG - Intergenic
950878914 3:16305402-16305424 TGAGTCAGCAACAGGGTGGCAGG - Exonic
951522719 3:23624474-23624496 TGAGGGAGTGAATGTGTGGGTGG + Intergenic
951704128 3:25526689-25526711 TGAGTGGGTGAATGAATGGCTGG + Intronic
951876062 3:27427202-27427224 TGGCTGGGTGATTGGGTGGCAGG - Intronic
952582844 3:34854882-34854904 TCCGTGAGTGAGTGGGAGGCAGG - Intergenic
952772408 3:37014185-37014207 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
952772410 3:37014189-37014211 TGAGTGGGTGGGTGGGTGGGTGG + Intronic
952846054 3:37688971-37688993 TGAGTGGATGACTGGCTGGGTGG + Intronic
952846059 3:37688995-37689017 TGGGTGTGTGAGTGGATGGCTGG + Intronic
952846060 3:37688999-37689021 TGTGTGAGTGGATGGCTGGCTGG + Intronic
952846069 3:37689035-37689057 TGGGTGAGTGGATGGCTGGCTGG + Intronic
952906269 3:38141003-38141025 TGTGTGAGTGAATGTGTGCCAGG + Intronic
952960277 3:38584945-38584967 TGAGTGAGTGAATGGATGGATGG + Intronic
953026598 3:39148666-39148688 TGAGTGACTGGGTGGGTGGTGGG - Intronic
953026600 3:39148670-39148692 GGCTTGAGTGACTGGGTGGGTGG - Intronic
953660777 3:44890149-44890171 TGAGTGAGGGACCTGGTGGGAGG - Intronic
953895618 3:46797385-46797407 TGAGTCAGTGAGTGAGTGGTGGG - Intronic
953926316 3:46984434-46984456 GGTTTGAGTGCCTGGGTGGCTGG - Intronic
953954449 3:47220534-47220556 TGAGTGAGTGGAAGGGTGGATGG - Intergenic
954097787 3:48343957-48343979 TGAGTCAGTGAGTGAGTGGTGGG + Intergenic
954424558 3:50436489-50436511 TGAGTGGGTCTCTAGGTGGCAGG + Intronic
954608775 3:51933372-51933394 TGCATGAGGGACTGGGTGGGAGG - Intergenic
954750191 3:52809228-52809250 TGGGTGAGTGAATGGATGGATGG - Intergenic
955007874 3:54986727-54986749 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
955026155 3:55169616-55169638 TGAGTGAGTGAGTGAATGGATGG - Intergenic
955042522 3:55331721-55331743 TGAGTAGGTGGGTGGGTGGCTGG + Intergenic
956253085 3:67254556-67254578 TGAGGGAGGGACCAGGTGGCAGG + Intergenic
956924063 3:73963446-73963468 TGAGTGAGTGAATGAATGGATGG + Intergenic
957070548 3:75564627-75564649 TGAGTGGGTGAGGGGGTGGAGGG + Intergenic
957071088 3:75568373-75568395 TTATAGAGTGATTGGGTGGCAGG - Intergenic
957174401 3:76787134-76787156 TGAGTGAGGGACATGGTGGGAGG - Intronic
957437928 3:80203122-80203144 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
957437930 3:80203126-80203148 TGTGTGGGTGAGTGGGTGGGTGG - Intergenic
957725922 3:84067156-84067178 TGAGTCAGTTACTGGGTGGTAGG + Intergenic
959405174 3:105952861-105952883 GGAGGGAGGGACTGGGTGGGAGG - Intergenic
960535925 3:118814096-118814118 TGTGTGTGTGTCTGGGTGTCTGG + Intergenic
961283536 3:125781909-125781931 TGAGTGGGTGAGGGGGTGGAGGG - Intergenic
961315259 3:126030720-126030742 TGGGTGAGTGGCTGGGTTGATGG + Intronic
961572137 3:127806706-127806728 TGAATGAATGAATGGATGGCTGG + Intronic
961661242 3:128469892-128469914 TGTGTGGGTGGCTGGGTGGGTGG - Intergenic
961661254 3:128469924-128469946 TGAGTGGCTGGCTGGGTGGGTGG - Intergenic
961661256 3:128469928-128469950 TGGGTGAGTGGCTGGCTGGGTGG - Intergenic
961661258 3:128469932-128469954 TGGGTGGGTGAGTGGCTGGCTGG - Intergenic
961661268 3:128469968-128469990 TGTATGAGTGGCTGGGTGGCTGG - Intergenic
961661274 3:128469992-128470014 TGGGTGGGTGGCTGGGTGGCTGG - Intergenic
961661284 3:128470016-128470038 TGTATGGGTGGCTGGGTGGCTGG - Intergenic
961661292 3:128470040-128470062 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
961661295 3:128470048-128470070 TGTATGGGTGGCTGGGTGGCTGG - Intergenic
961661303 3:128470072-128470094 TGTGTGGGTGGCTGGGTGGCTGG - Intergenic
961661326 3:128470144-128470166 TGTGTGGGTGGCTGGGTGGCTGG - Intergenic
961661342 3:128470200-128470222 TGTGTGGGTGGCTGGGTGGCTGG - Intergenic
962062018 3:131938741-131938763 TGAGGGAGGGACTTGGTGGGAGG - Intronic
962281649 3:134056734-134056756 TGAGTGTGTGAGTGGGTGTGTGG + Intergenic
962540300 3:136374863-136374885 TGAGTGAGTGAATGAGTGATTGG - Intronic
963071539 3:141309047-141309069 TGAGTAATTGACTGGCTGGTTGG + Intergenic
963171646 3:142257188-142257210 TGAGTCAGTTCCCGGGTGGCGGG + Intergenic
963733379 3:148992770-148992792 AGTGTGAGTGACTGGGAAGCTGG + Intronic
964068537 3:152604526-152604548 TGAGTAAGTTCCTGGGTGGGGGG + Intergenic
964875605 3:161365242-161365264 TGACTGAGTGGCTAGCTGGCTGG - Intronic
965258439 3:166446485-166446507 TGGGTGAGTCACTGGGTGAGTGG + Intergenic
965682402 3:171264913-171264935 TGAGAGAGGTAGTGGGTGGCGGG + Intronic
967045812 3:185735868-185735890 TGAGTGAATGAATGGGGGGTGGG + Intronic
967977557 3:195044034-195044056 TGAGGGAGAGACTGGGTCCCAGG + Intergenic
968402641 4:311894-311916 AGAATGAGTGTCTTGGTGGCAGG + Intergenic
968733443 4:2283108-2283130 TGAGTGGGTGGGTGGGTGGATGG - Intronic
968733537 4:2283467-2283489 TGAATGAGTGGATGGGTGGATGG - Intronic
968928124 4:3560701-3560723 TGGGTGGGTGAATGGGTGGATGG - Intergenic
968930948 4:3578457-3578479 TGGGTGAGTGAATGGATGGGTGG - Intronic
968942243 4:3644849-3644871 TGAATGAATGAATGTGTGGCGGG + Intergenic
968942308 4:3645162-3645184 TGAATGAATGAATGTGTGGCAGG + Intergenic
969014169 4:4092299-4092321 TGAGTGGGTGAGGGGGTGGAGGG + Intergenic
969184414 4:5464811-5464833 TGAATGAATGAATGAGTGGCAGG + Intronic
969184418 4:5464869-5464891 TGAATGAATGAATGAGTGGCAGG + Intronic
969202207 4:5615290-5615312 TGAGTGAGTGAGCGGTTGGGTGG + Intronic
969205412 4:5640288-5640310 TGAGTGGGTGAATGGGTAGATGG + Intronic
969216717 4:5729076-5729098 TGGGTGAATGAATGGGTGGGTGG - Intronic
969352503 4:6605903-6605925 TGAATGAATGAATGGGTGGTTGG - Intronic
969481876 4:7450829-7450851 TGAGTGAGTGAATGAGTGAATGG + Intronic
969492306 4:7506474-7506496 TGAGTGGGTGGGTGGGTGGATGG - Intronic
969492307 4:7506478-7506500 TGAATGAGTGGGTGGGTGGGTGG - Intronic
969492309 4:7506482-7506504 TGAATGAATGAGTGGGTGGGTGG - Intronic
969499307 4:7543467-7543489 TGAGTGGGTGAATGGATGGGTGG - Intronic
969499329 4:7543559-7543581 TGAGTGGGTGAATGGATGGGTGG - Intronic
969499420 4:7543872-7543894 TGGGTGGGTGGGTGGGTGGCTGG - Intronic
969501646 4:7556931-7556953 TGAGTGAGTGGGTGGATGGATGG - Intronic
969501647 4:7556935-7556957 TATGTGAGTGAGTGGGTGGATGG - Intronic
969510374 4:7614266-7614288 TGGGTGAGTGGATGGGTGGATGG - Intronic
969517805 4:7657763-7657785 TGAGTGAGTGAGTCTGTGACTGG + Intronic
969517807 4:7657799-7657821 TGAGTGAGTGAATGAGTGAGTGG + Intronic
969517824 4:7658300-7658322 TGAGTGAGTGAGTCTGTGACTGG + Intronic
969517826 4:7658308-7658330 TGAGTCTGTGACTGGGTGAGTGG + Intronic
969524044 4:7695297-7695319 TGGGTGAGTGAATGGGTGGGTGG + Intronic
969524046 4:7695301-7695323 TGAGTGAATGGGTGGGTGGGTGG + Intronic
969524103 4:7695477-7695499 TGGGTGAGTGGATGGGTGGGTGG + Intronic
969524110 4:7695497-7695519 TGGGTGAGTGGATGGGTGGGTGG + Intronic
969524117 4:7695517-7695539 TGGGTGAGTGGATGGGTGGGTGG + Intronic
969565404 4:7974431-7974453 TGAGTGGGTGGGTGGGTGGAAGG - Intronic
969624424 4:8295111-8295133 TGAATGAGTGGGTGGGTGGATGG - Intronic
969687447 4:8683587-8683609 TGAGTGGGTGGATGGGTGGATGG + Intergenic
969687525 4:8683955-8683977 TGGGTGGGTGAATGGGTGGGTGG + Intergenic
969739817 4:9016125-9016147 TGAGTGGGTGAGGGGGTGGAGGG - Intergenic
969798974 4:9547645-9547667 TGAGTGGGTGAATGGGTGGAGGG - Intergenic
969928302 4:10605934-10605956 TGAGTCAGTGAGTGAGTGGTGGG + Intronic
970019097 4:11546968-11546990 TGTGTGTGTGAGTGGCTGGCTGG + Intergenic
970100492 4:12515562-12515584 TGAGTGAGAGACTTGGTGGGAGG + Intergenic
971048273 4:22830700-22830722 TGAGTGGGTGAGTGAGTGGATGG - Intergenic
971198507 4:24491698-24491720 TGGGTGGGTGACTGGATGGATGG + Intergenic
971198597 4:24492104-24492126 TGTGTGAGTGACTGGATGGATGG + Intergenic
971287243 4:25302456-25302478 CGAGTGAGTGAGTGAGTGACTGG - Intergenic
971535182 4:27738974-27738996 TGAGGGAGAGACTTGGTGGGAGG - Intergenic
972054228 4:34780071-34780093 TGAGGGAGAGACCTGGTGGCAGG - Intergenic
972159670 4:36208118-36208140 TAAGGGAGTGATGGGGTGGCAGG + Intronic
972169309 4:36325646-36325668 TGTGTGTGGGACTGGGTGGCAGG + Intronic
972602132 4:40582046-40582068 TCAGTGACTGACTGGGTGAAGGG - Intronic
973597400 4:52506620-52506642 TGAATGAATGAATGGGTGGAAGG + Intergenic
974403056 4:61428141-61428163 GGAGTGGGTGAATGGATGGCAGG + Intronic
974718014 4:65696170-65696192 TGAATGAGTGAATGGATGGATGG + Intergenic
975120788 4:70726191-70726213 TGACTGAGGGGCTGGGTGGCTGG + Intronic
975870229 4:78772043-78772065 TGTGTGTGTGTCTGGGTGGGTGG - Intergenic
976003831 4:80403648-80403670 GTAGTATGTGACTGGGTGGCTGG - Intronic
976759838 4:88536449-88536471 TGAGTGAGTGAGTATGTGTCGGG - Intronic
977594551 4:98864722-98864744 TGAGGGGGTGAGTGGTTGGCGGG - Intergenic
978624860 4:110673705-110673727 TGAGTGAGTGAGTGAGTGGTGGG - Intergenic
979106389 4:116694157-116694179 TGAGTGAGAGACCTGGTGGGAGG + Intergenic
980424616 4:132610655-132610677 TGAGTGAGTGAGTGAGTGAGTGG + Intergenic
980573052 4:134648384-134648406 TGAGGGAGAGACTTGGTGGGAGG - Intergenic
981202767 4:142000922-142000944 TGAGTGAGTGAGTGAGTGAGTGG + Intergenic
981222442 4:142253211-142253233 TGAGTCAGTGAGTGAGTGGTGGG + Intronic
981362457 4:143863176-143863198 TGTGTGTGTGTCTGGGAGGCAGG + Intergenic
981382283 4:144087214-144087236 TGTGTGTGTGTCTGGGAGGCAGG + Intergenic
981531684 4:145760489-145760511 TGAGAGTGGGAGTGGGTGGCTGG + Intronic
982166336 4:152616988-152617010 TGGGTGAGTGGATGGGTGGGTGG - Intergenic
982660917 4:158205607-158205629 TGAGAGAGGGACTTGGTGGGAGG + Intronic
982936213 4:161479933-161479955 TGGGTGAGTGAATGGATGGATGG + Intronic
983013987 4:162586440-162586462 TGAGTGAGTCAGTGGGTGATTGG + Intergenic
983578303 4:169282604-169282626 TGAGTCAGTGAGTGAGTGGTGGG - Intergenic
984248549 4:177305059-177305081 TGAGTCAGTGAGTGAGTGGTGGG - Intergenic
984374987 4:178918383-178918405 TGAGTGTGTGTGTGGGTGGGTGG - Intergenic
984701931 4:182824145-182824167 TGATTCAGTTACTGGGTGGGGGG - Intergenic
985380545 4:189390297-189390319 TGAGTGGGTGAGTGGGTGGATGG + Intergenic
985432272 4:189892903-189892925 TGAGTTCCTGACTAGGTGGCAGG + Intergenic
985547482 5:517159-517181 TGAGTGAGTGGATGGGTGAATGG - Intronic
985547548 5:517586-517608 TGGGTGAGTGAGTGGATGGATGG - Intronic
985560532 5:583947-583969 TGGTTGAGTGGCTGGGTGGATGG + Intergenic
985560555 5:584023-584045 TGGGTGAGTGGATGGGTGGGCGG + Intergenic
985560567 5:584055-584077 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
985560568 5:584059-584081 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
985560586 5:584111-584133 TGGGTGAGTGGATGGGTGGACGG + Intergenic
985560608 5:584183-584205 TGAGTGGGTAAGTGGGTGGGTGG + Intergenic
985560612 5:584195-584217 TGGGTGGGTGGATGGGTGGCTGG + Intergenic
985560637 5:584294-584316 TGGGTGGGTGAGTGGATGGCTGG + Intergenic
985560701 5:584550-584572 TGGGTGAGTGGCTGGCTGGTTGG + Intergenic
985560720 5:584606-584628 TGGGTGGGTGAATGGGTGGCTGG + Intergenic
985560733 5:584650-584672 TGGGTGAGTGGCTGGCTGGTTGG + Intergenic
985560752 5:584706-584728 TGGGTGGGTGAATGGGTGGCTGG + Intergenic
985560769 5:584762-584784 TGGGTGAGTGGCTGGATGGGTGG + Intergenic
985560819 5:584942-584964 TAAGTGGGTGGCTGGGTGGGTGG + Intergenic
985560840 5:585010-585032 TGGGTGGGTGGCTGGCTGGCTGG + Intergenic
985560853 5:585058-585080 TGGGTGGGTGGTTGGGTGGCTGG + Intergenic
985662855 5:1166011-1166033 TGGGTGGGTGAGTGGGTGGATGG - Intergenic
985662867 5:1166055-1166077 TGGGTGGGTGAGTGGGTGGATGG - Intergenic
985797876 5:1977054-1977076 TGAGTGAGTGAGTGAATGGCTGG + Intergenic
985821115 5:2160922-2160944 TGAGTGGGTGAATGGGTGGATGG - Intergenic
985821148 5:2161070-2161092 TGAGTGGGTGAATGGGTGGATGG - Intergenic
985821170 5:2161161-2161183 TGAATGAGTGGGTGGGTGGATGG - Intergenic
985829658 5:2219156-2219178 TGGGTGAGTGAATGGATGGGTGG - Intergenic
985837208 5:2280299-2280321 TGGGTGAGTGAGTGGTTGGGTGG + Intergenic
985837376 5:2280999-2281021 TGGGTGGGTGAATGGGTGGGTGG + Intergenic
985837508 5:2281498-2281520 TGGGTGGATGACTGGGTGGGTGG + Intergenic
985874398 5:2584457-2584479 TGAATGAGTGGTTGGGTGGATGG + Intergenic
985874411 5:2584505-2584527 TGACTGGGTGAGTGGGTGGATGG + Intergenic
985874674 5:2585681-2585703 TGGGTGGGTGATTGGGTGGGTGG + Intergenic
986020272 5:3795148-3795170 TGGGTGGGTGGCTGAGTGGCTGG + Intergenic
986020282 5:3795184-3795206 TGGGTGGGTGAATGGGTGGATGG + Intergenic
986176432 5:5355961-5355983 TGAATGAGTGGCTGGCTGGATGG + Intergenic
986237444 5:5925474-5925496 TGAGTGGGTTTCTGGCTGGCTGG - Intergenic
986245983 5:6007176-6007198 TGAGTGAGTGAGTGAGTGCATGG + Intergenic
986273189 5:6251910-6251932 TGCCTGGGTGGCTGGGTGGCTGG - Intergenic
986523999 5:8653065-8653087 TGAGGGAATGACTGGGGTGCTGG - Intergenic
987068075 5:14308927-14308949 TGGTTGGGTGACTGGGTGGATGG - Intronic
987068099 5:14309025-14309047 TGAATGAGTGGCTGAGTGGCTGG - Intronic
987483390 5:18490359-18490381 TGAATGAGTGGCTGAGTGGATGG - Intergenic
987602105 5:20084808-20084830 TGACTGAGTGGCTGGGATGCAGG + Intronic
988443235 5:31256245-31256267 TGAGTGATTTACTGGCTGTCAGG + Intronic
988482419 5:31640844-31640866 TGAGTGAGTGTGTGTGTTGCGGG + Intronic
988577899 5:32444476-32444498 TGAGTGAGGGAGTGCGAGGCGGG - Intronic
988783191 5:34541996-34542018 TGAGTGAGTTTCTGGGTGGGGGG + Intergenic
988954196 5:36297943-36297965 TCTGTGAGTGACTAGGTGGAAGG + Intronic
989466786 5:41765773-41765795 TGAGTGAGTGAATGAATGGATGG + Intronic
989681467 5:44034300-44034322 TGTGGGAGGGACTGGGTGGGAGG + Intergenic
990165876 5:52992624-52992646 TGAGGGACTGACTGGGTGGCAGG - Intronic
990365679 5:55067768-55067790 AGACTGAGTGAGTGGGTGGATGG + Intergenic
990365680 5:55067772-55067794 TGAGTGAGTGGGTGGATGGATGG + Intergenic
990705845 5:58528563-58528585 AGAGTGAGTGAGAGGGTGGAAGG + Intergenic
991168575 5:63593411-63593433 TGAGTAAGTGCCTGCTTGGCTGG - Intergenic
991538296 5:67697613-67697635 AGAGTGACTGGCTGGGTGGATGG - Intergenic
991538297 5:67697617-67697639 TGACAGAGTGACTGGCTGGGTGG - Intergenic
992069574 5:73136504-73136526 TGGGTGAGTGAGTAGGTCGCGGG + Intergenic
992830709 5:80590746-80590768 TGGGTGAATGACCGGGTGGAGGG + Intergenic
993861818 5:93145479-93145501 TGAGGGAGTGATTGGATGGATGG - Intergenic
994544298 5:101143633-101143655 TGAGGGAGGGACTTGGTGGGAGG + Intergenic
995138559 5:108706721-108706743 TGAATGAATGGCTGGCTGGCTGG + Intergenic
995335863 5:110998838-110998860 TGAGTGAGTGTCTGAGAGGTAGG + Intergenic
995589271 5:113682161-113682183 TGGGTGAGTGATTGGGTGAGTGG - Intergenic
996038647 5:118786470-118786492 TGTGTGTGTGTCTGTGTGGCAGG + Intergenic
996356587 5:122601994-122602016 TGAGAGAGAGACTTGGTGGGAGG - Intergenic
996628859 5:125603515-125603537 TCAGTGAGTCACTGAGTGGGTGG + Intergenic
997185496 5:131877767-131877789 TGGATGGGTGACTGGGGGGCAGG - Intronic
997231905 5:132251552-132251574 TGACTGAGTCACAGGCTGGCGGG - Intronic
997659712 5:135579695-135579717 TGTGTGAGTGTCTGGGTGGTGGG + Intergenic
998132279 5:139657472-139657494 TGAATGAATGACTGGATGACTGG + Intronic
998164518 5:139835345-139835367 TGGGTGAGTGAATGGATGGATGG - Intronic
998164544 5:139835555-139835577 TGGGTAAGTGAGTGGGTGGGTGG - Intronic
998522021 5:142809754-142809776 TGAATGAGTGATTGGATGGATGG - Intronic
998627263 5:143860116-143860138 TGAGGGAGTGAATGCTTGGCAGG - Intergenic
998928815 5:147157677-147157699 TGAGAGAGTGTCTGGGAGGTTGG + Intergenic
999428022 5:151504320-151504342 AGAGGGAGGGACTGGGTGGGAGG + Exonic
999451162 5:151679338-151679360 TGAGTGAGTGACTGGGTGGCAGG + Intronic
1000026474 5:157363293-157363315 TGAATGAGTGGATGGATGGCTGG - Intronic
1000128441 5:158270694-158270716 TGAGTGGGTGAAATGGTGGCAGG - Intergenic
1001329822 5:170754320-170754342 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
1001329823 5:170754324-170754346 TGAGTGGGTGGGTGGGTGGATGG + Intergenic
1001329878 5:170754520-170754542 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1001329895 5:170754572-170754594 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
1001329896 5:170754576-170754598 TGAGTGGGTGGGTGGGTGGATGG + Intergenic
1001329961 5:170754852-170754874 TGAGTGGGTGGGTGGGTGGGTGG + Intergenic
1001440315 5:171737809-171737831 TGAGTGAGTGATTTGGGGCCGGG - Intergenic
1001489953 5:172148289-172148311 GGTGTGAGTGACAGGGTGGGGGG + Intronic
1001492072 5:172162959-172162981 TGAGTGAGGTGCTGGGTAGCGGG - Intronic
1001686387 5:173597683-173597705 TGAGTGGGTGAGTGGATGGAGGG - Intergenic
1001833712 5:174811689-174811711 TGGGTGGGCGACTGGCTGGCTGG - Intergenic
1001840384 5:174871284-174871306 TGAGTGAGTGGGTGGGTGGGTGG - Intergenic
1001840386 5:174871288-174871310 TAAGTGAGTGAGTGGGTGGGTGG - Intergenic
1001840388 5:174871292-174871314 TGAGTAAGTGAGTGAGTGGGTGG - Intergenic
1001900132 5:175420404-175420426 TGGGTGAGTGTGTGGGTGGATGG - Intergenic
1002201127 5:177528980-177529002 TGAGTGAGTGAGTGAGTGATGGG + Intronic
1002903209 6:1427107-1427129 TGAGTGGGTGAGTGGGTGAGTGG + Intergenic
1002917978 6:1544268-1544290 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1003667972 6:8129223-8129245 TGAGTGGGTGGGTGGGTGGATGG - Intergenic
1003667973 6:8129227-8129249 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1004424849 6:15500356-15500378 TGTGTGAGTGAGTGGGTGGATGG + Intronic
1004591079 6:17052514-17052536 TGAGTGAGTGAGTGAGTGGGTGG - Intergenic
1005087348 6:22020937-22020959 GGAATGAGTGACTGGGGAGCAGG - Intergenic
1005179006 6:23082239-23082261 TGTGTGTGTGATTGGGGGGCAGG + Intergenic
1005315173 6:24597039-24597061 TGAGTGGGTGGATGGGTGGAGGG - Intronic
1006081184 6:31567812-31567834 AGAGAGAGAGACTGGGAGGCGGG - Intergenic
1006327488 6:33365235-33365257 TGAGTGAGTGGGTCAGTGGCTGG + Intergenic
1006606393 6:35260189-35260211 TGAGGGAGTCACTGGTTGGTGGG - Intronic
1007795047 6:44340294-44340316 TGAGTGGGTGGGTGGGTGGATGG - Intronic
1007795048 6:44340298-44340320 TGAGTGAGTGGGTGGGTGGGTGG - Intronic
1007795050 6:44340302-44340324 TAAATGAGTGAGTGGGTGGGTGG - Intronic
1007847978 6:44776497-44776519 TGAGTGAGTGGATGGATGGATGG + Intergenic
1008067596 6:47066603-47066625 TGAGTGAGTCAGTGGGTGAGTGG - Intergenic
1010186180 6:73146008-73146030 TGGGGGAGGGACTGGGTGGGAGG - Intronic
1011240543 6:85267448-85267470 TGTGGGAGGGACTGGGTGGGAGG - Intergenic
1013294795 6:108749484-108749506 TGAGTGGATTACTGGGTGGGTGG + Intergenic
1014142338 6:117958426-117958448 TGAGTCAGTGAGTGAGTGGTTGG - Intronic
1014579475 6:123118765-123118787 TCAGTGAGTGAGTGAGTGGTGGG - Intergenic
1015484383 6:133751929-133751951 TGAGTAAGTGACTGTGTAGGAGG - Intergenic
1015695809 6:135978370-135978392 TGAGTGAGTGAGTGAGTGAGTGG + Intronic
1015937116 6:138415305-138415327 TGAGTGACTCACTGTCTGGCTGG + Exonic
1016683445 6:146856046-146856068 TGAGTGAGTGACTGTATGAATGG - Intergenic
1016844316 6:148556153-148556175 TGAGGGAGTGAATGAGGGGCTGG - Intergenic
1017694384 6:156999987-157000009 GGAGTGAGTGAGTGAGTGGGAGG + Intronic
1017729713 6:157304745-157304767 TCAGAGAGTAACTGGGTGGTGGG + Intronic
1017821696 6:158053769-158053791 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1017821697 6:158053773-158053795 TAAGTGGGTGAGTGGGTGGGTGG - Intronic
1017986394 6:159446465-159446487 TGTGTGAGTGTCTGGTTGTCTGG - Intergenic
1018610466 6:165643220-165643242 TAGGTGAGTGAGTGGGTGGGTGG + Intronic
1018610468 6:165643224-165643246 TGAGTGAGTGGGTGGGTGGGTGG + Intronic
1018610469 6:165643228-165643250 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1018832378 6:167453012-167453034 TGAGTGAGTGACCAGATGGGAGG - Intergenic
1019055336 6:169219218-169219240 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1019103417 6:169650105-169650127 TGAGTGAGTGGATGGATGGAGGG - Intronic
1019255192 7:45273-45295 TGAGTGAGTGAGCGGGTGAGTGG - Intergenic
1019327107 7:443881-443903 TGAGTGGGTGGGTGGGTGGGTGG + Intergenic
1019330651 7:459024-459046 TGAGTCAGAGACTGGAAGGCGGG - Intergenic
1019369902 7:656545-656567 TGAGTGAGGGAATGGATGGATGG + Intronic
1019510562 7:1415468-1415490 TGAGTGGGTGGATGGGTGGGTGG + Intergenic
1019510573 7:1415508-1415530 TGAGTGGGTGGATGGGTGGGTGG + Intergenic
1019510663 7:1415858-1415880 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
1019516415 7:1442168-1442190 TGAGTAAGGGGCTGGGAGGCAGG - Intronic
1019676392 7:2314956-2314978 GCAGTGAGTGAGTGAGTGGCTGG - Intronic
1019676534 7:2316781-2316803 TGAGTGAGTGAGTGGGTGGGTGG - Intronic
1019676536 7:2316785-2316807 TGAGTGAGTGAGTGAGTGGGTGG - Intronic
1019704657 7:2491753-2491775 TGGGTGGGTGAGTGGGTGGGTGG - Intergenic
1019704719 7:2492044-2492066 TGAGTGGGTGGGTGGGTGGATGG - Intergenic
1019704720 7:2492048-2492070 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1019704722 7:2492052-2492074 TGGGTGGGTGAGTGGGTGGGTGG - Intergenic
1019704738 7:2492111-2492133 TGAGTGGGTGAGTGGGTGGATGG - Intergenic
1019704796 7:2492382-2492404 TGAGTGGGTGGATGGATGGCTGG - Intergenic
1019704798 7:2492390-2492412 TGGGTGGGTGAGTGGGTGGATGG - Intergenic
1019784926 7:2969878-2969900 TGAGTGAGTGAATGGATGAGTGG - Intronic
1019784929 7:2969914-2969936 TGAGTGAGTGAATGAGTGAATGG - Intronic
1019784933 7:2970022-2970044 TGAGTGAGTGAATGAGTGAATGG - Intronic
1019784934 7:2970046-2970068 TGAGTGAGTGAATGAGTGAATGG - Intronic
1019784947 7:2970262-2970284 TGAGTGAATGAGTGAATGGCTGG - Intronic
1019784948 7:2970266-2970288 TGAGTGAGTGAATGAGTGAATGG - Intronic
1020192346 7:6009618-6009640 TGAGTGAGTCCCTGGCCGGCCGG - Intronic
1021263588 7:18490846-18490868 TGAGTGAGTGAGTGAGTGAGTGG + Intronic
1021951051 7:25775458-25775480 TCAGTCAGTGAGTGAGTGGCGGG - Intergenic
1022460417 7:30599902-30599924 TGAGTGAGTGGAGGGGTGGGTGG - Intronic
1022531884 7:31071999-31072021 TGGGTGGGTGGGTGGGTGGCTGG - Intronic
1022642674 7:32203169-32203191 TGAGTGGGGGACTGTGTGGCTGG - Intronic
1022971754 7:35524603-35524625 TGAGTCAGTGAATGAGTGGTGGG + Intergenic
1023383643 7:39633545-39633567 TGAGGGAGGGACTAGGTGGGAGG - Intronic
1023464761 7:40441913-40441935 TGAGTGAGTTTCTGGGTGGGGGG + Intronic
1023582865 7:41700674-41700696 GGAGGGAGAGACAGGGTGGCGGG + Intronic
1023943172 7:44783040-44783062 TGAGTGTGTTTCTGGGTGGTTGG - Intergenic
1024093621 7:45967650-45967672 TGAGTGAGTCTCAGGGAGGCTGG - Intergenic
1024338184 7:48230759-48230781 TGAGTGAGTGGATGGATGGATGG - Intronic
1024775422 7:52779440-52779462 TGAGTCAGTTCCTGGGTGGTGGG - Intergenic
1025211597 7:57022247-57022269 TGGCTGGGTGACTGGGAGGCAGG - Intergenic
1025660359 7:63554580-63554602 TGGCTGGGTGACTGGGAGGCAGG + Intergenic
1025709295 7:63892089-63892111 CCACTGAGTGCCTGGGTGGCAGG + Intergenic
1026097573 7:67358583-67358605 TGAGTCAGTTCCTGGGTGGGAGG + Intergenic
1026146494 7:67751027-67751049 TGTGGGAGGGACTGGGTGGGAGG - Intergenic
1026205036 7:68249729-68249751 TGAGTGAATGAATGAGTGGGTGG + Intergenic
1026319631 7:69257579-69257601 TGATTGATTGGCTGGCTGGCTGG + Intergenic
1027459454 7:78434892-78434914 TGAGGGAGTTGCTGGCTGGCTGG + Intronic
1027839036 7:83283907-83283929 TGGGTGAGTGAGTGAGTGACTGG - Intergenic
1027943478 7:84715511-84715533 TGTGTGAGTGTGTGTGTGGCGGG + Intergenic
1029116948 7:98242506-98242528 TGAGTGGGTGAGTGGGTGTATGG - Intronic
1029116988 7:98242675-98242697 TGAGTGGGTGAGTGGGTGTATGG - Intronic
1029117043 7:98242892-98242914 TGGGTGGGTGAGTGGGTGGGTGG - Intronic
1029489365 7:100861921-100861943 GGAGTGAGTGAGTGAGTGGGAGG - Intronic
1029559508 7:101293224-101293246 TGAGTCAGTTCCTGGGTGGTGGG - Intergenic
1029599694 7:101556424-101556446 TGAGTGAGTGAACGAATGGCTGG + Intronic
1029599726 7:101556636-101556658 TGAATGAGTGAATGGATGGATGG + Intronic
1029599746 7:101556751-101556773 TGAATGAATGAATGGGTGGATGG + Intronic
1029599757 7:101556803-101556825 TAAGTGAGTGAATGGATGGATGG + Intronic
1029599802 7:101557086-101557108 TAAATGAGTGACTGAGTGGGTGG + Intronic
1029971725 7:104796245-104796267 AGAGTGTGTGACCGGGGGGCTGG + Intronic
1030088456 7:105837065-105837087 CGAGAGAGTGAGTGGGTGGGGGG + Intronic
1030432462 7:109468252-109468274 TGAGTGAGGGAATGGATGGATGG - Intergenic
1031005311 7:116463840-116463862 TGAGAGAGGGACTTGGTGGGAGG - Intronic
1031356753 7:120796796-120796818 TGGGTGGGTGAGTGGGTGGATGG - Intronic
1031865550 7:127035404-127035426 TGATTGATTGACTGGCTGGTTGG + Intronic
1031922543 7:127612544-127612566 TGGGTGGGTGACTGGCTGGCTGG + Intronic
1032077056 7:128840968-128840990 TGGGTAAGTGGCTGGGGGGCAGG + Exonic
1032504902 7:132427479-132427501 TGAGTTTATGACTGGGTGGGTGG - Intronic
1032622992 7:133556945-133556967 TCAGTGAGTGAGTGAGTGACTGG + Intronic
1032924070 7:136581746-136581768 TGAGTGAGGGACCTGGTGGGAGG + Intergenic
1033264457 7:139872858-139872880 TGGGTGAGTGAATGGATGACAGG - Intronic
1033927683 7:146483957-146483979 TGAGTCAGTGAGTGGGTGGTGGG - Intronic
1034279242 7:149840544-149840566 TGAGTGAGTGAGTGAGTGAGTGG - Intronic
1034391699 7:150792246-150792268 AGAGTCAGTGCCTGGGTGGGTGG - Intronic
1034621261 7:152458948-152458970 TGAGAGAATGACTTGGTGCCAGG + Intergenic
1034839066 7:154378962-154378984 TGAGGGAGGGACTTGGTGGGAGG - Intronic
1035014656 7:155754453-155754475 TCTGTGAGGGACTGTGTGGCTGG + Intronic
1035030888 7:155858817-155858839 TGAGTGTGTGTTTGAGTGGCAGG + Intergenic
1035048059 7:155981948-155981970 TGAGTGGGTGGGTGGGTGGATGG - Intergenic
1035058824 7:156054085-156054107 TGAGTGGGTGAGTGGATGGATGG - Intergenic
1035196428 7:157224814-157224836 TGAGTGAGTGAGTGAGTGAGTGG - Intronic
1035225554 7:157430358-157430380 TGAGTGGGTGGGTGGGTGGATGG - Intergenic
1035278803 7:157764755-157764777 AGAGTGAGAGACTGCGTGCCTGG + Intronic
1035286124 7:157808304-157808326 TGAGTGAGTACGTGAGTGGCAGG + Intronic
1035318551 7:158013711-158013733 TGAGTGGGTGGCTGGCTGGATGG - Intronic
1035318553 7:158013719-158013741 TGGGTGGATGAGTGGGTGGCTGG - Intronic
1035318578 7:158013800-158013822 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1035318591 7:158013840-158013862 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
1035318593 7:158013844-158013866 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1035318595 7:158013848-158013870 TGGGTGGGTGAGTGGGTGGGTGG - Intronic
1035318637 7:158014032-158014054 TGAGTGGGTGGGTGGGTGGATGG - Intronic
1035318638 7:158014036-158014058 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1035318640 7:158014040-158014062 TGGGTGGGTGAGTGGGTGGGTGG - Intronic
1035527425 8:324707-324729 TGAGTGAGTAGGTGGGTGGAGGG + Intergenic
1035647928 8:1242701-1242723 TGAGTGAGTGCATAGGTGGGTGG + Intergenic
1035673317 8:1436717-1436739 TGGGTGAGTGAATGGGTGAGTGG - Intergenic
1036244845 8:7107368-7107390 TGAGTGGGTGAGGGGGTGGAGGG - Intergenic
1036302332 8:7577067-7577089 AGATTGAGTGACTGGGAGCCGGG - Intergenic
1036303621 8:7584711-7584733 AGATTGAGTGACTGGGAGCCGGG - Intergenic
1036324157 8:7766897-7766919 AGATTGAGTGACTGGGAGCCGGG + Intergenic
1036351883 8:8017410-8017432 AGATTGAGTGACTGGGAGCCGGG - Intergenic
1036353184 8:8025056-8025078 AGATTGAGTGACTGGGAGCCGGG - Intergenic
1036354475 8:8032703-8032725 AGATTGAGTGACTGGGAGCCGGG - Intergenic
1036557216 8:9870636-9870658 TTAGTGAGAGACTGGGTGAAGGG + Intergenic
1036896978 8:12644088-12644110 TGAGTGGGTGAGGGGGTGGAGGG + Intergenic
1037721324 8:21446814-21446836 TAATTGTGTGACTGGGTGTCTGG - Intergenic
1038077379 8:24091563-24091585 TGTGTGTGTGGCTGGCTGGCCGG + Intergenic
1038485387 8:27931433-27931455 GGGGTGAGGCACTGGGTGGCTGG - Intronic
1039113977 8:34071632-34071654 TGAGTTTGTGGCTGGGTGGGTGG + Intergenic
1039279735 8:35971139-35971161 TGATTGAGTCATTGGGTGGGTGG + Intergenic
1040045692 8:42961431-42961453 TGAGTGAGTGAATGAGTGGGTGG + Intronic
1040584407 8:48726336-48726358 TGAGTGGGTGGATGGGTGGATGG - Intronic
1040731645 8:50454543-50454565 TGTCTGAGTGGCTGGGTGGCAGG + Intronic
1041354453 8:56985469-56985491 GGAGTGATTGGCTGGGTGTCGGG - Intronic
1041467124 8:58168012-58168034 TGTGTATGTGACTGGGTGGGGGG - Intronic
1041694230 8:60718785-60718807 TGAGTGAGTGAGTGAGTGAGTGG - Intronic
1042104182 8:65307211-65307233 TGGGGGAGGGACTGGGTGGGAGG - Intergenic
1042964317 8:74334536-74334558 TGAATGGGTGAGTGGGTGGGTGG - Intronic
1043570677 8:81599337-81599359 TGAGTCAGTTCCTGGGTGGGGGG + Intergenic
1044354316 8:91203206-91203228 TGAGTGTGTGTGTGGGTGGGTGG + Intronic
1044660340 8:94589070-94589092 TGAGTCAGTGAGTGAGTGGTGGG - Intergenic
1044783003 8:95762884-95762906 TGAGTGACTGACAGGGTTGTGGG + Intergenic
1044987768 8:97770023-97770045 TGAGTCAGTTCCTGGGTGGGGGG + Intergenic
1045186218 8:99841249-99841271 TCTGGGAGTGACTGGGTGACAGG - Intronic
1046157439 8:110311032-110311054 TGAGTGAGTGAGTGAGTGTCTGG + Intergenic
1047007216 8:120632788-120632810 TGAGTGAACGAATGGATGGCGGG - Intronic
1047215939 8:122876087-122876109 TGAGTGAGTAGGTGGGTGGAGGG - Intronic
1047546390 8:125821800-125821822 TGAGGGAGGGACTTGGTGGCAGG - Intergenic
1047657364 8:126992459-126992481 TGGGTGAGTGAATGGGTGGGTGG + Intergenic
1047657366 8:126992463-126992485 TGAGTGAATGGGTGGGTGGGTGG + Intergenic
1047991058 8:130287441-130287463 TCAGTGGGTGAATGGGTGGATGG - Intronic
1048375035 8:133815910-133815932 TGATTCAGTGCATGGGTGGCAGG + Intergenic
1048568637 8:135630845-135630867 TGGGTGAGTGAGTGAGTGGGTGG + Intronic
1049008341 8:139871864-139871886 TGAATGAGTTAGTGGGTGGCTGG + Intronic
1049024404 8:139978982-139979004 TGTGTGTGGGACTCGGTGGCCGG + Intronic
1049045037 8:140143042-140143064 GGAGTGAGTGAATGAGTGGCTGG + Intronic
1049236563 8:141515162-141515184 TGGGTGAGTGAATGGATGGCTGG - Intronic
1049236571 8:141515198-141515220 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1049363038 8:142221673-142221695 TGAGTGAGTGAGTGGATGAGTGG - Intronic
1049363043 8:142221809-142221831 TGAGTGAGTGAATGAGTGAGTGG - Intronic
1049363045 8:142221857-142221879 TGAGTGAGTGAATGAGTGAGTGG - Intronic
1049363047 8:142221905-142221927 TGAGTGAGTGAATGAGTGAGTGG - Intronic
1049363050 8:142221965-142221987 TGAGTGAGTGAGTGGATGAGTGG - Intronic
1049363053 8:142222037-142222059 TGAGTGAGTGAGTGGATGAGTGG - Intronic
1049363060 8:142222158-142222180 TGAGTGAGTGAGTGGATGAGTGG - Intronic
1049363062 8:142222182-142222204 TGAGTGAGTGAATGAGTGAGTGG - Intronic
1049363065 8:142222254-142222276 TGAGTGAGTGAGTGGATGAGTGG - Intronic
1049363071 8:142222392-142222414 TGAGTGAGTGAATGAGTGAGTGG - Intronic
1049363073 8:142222464-142222486 TGAGTGAGTGAGTGGATGAGTGG - Intronic
1049363083 8:142222676-142222698 TGAGTGAGTGAGTGGATGAGTGG - Intronic
1049363097 8:142223024-142223046 TGAGTGAGTGAATGAGTGAGTGG - Intronic
1049363099 8:142223146-142223168 TGAGTGAGTGAATGAGTGAGTGG - Intronic
1049363102 8:142223298-142223320 TGAGTGAGTGAATGAGTGAGTGG - Intronic
1049363104 8:142223480-142223502 TGAGTGAGTGAATGAGTGAGTGG - Intronic
1049363106 8:142223580-142223602 TGAGTGAGTGAATGAGTGAGTGG - Intronic
1049371946 8:142272196-142272218 TGGGTGAGTGGCTGGGTGGATGG - Intronic
1049416066 8:142495904-142495926 TGAGTGCATGAGTGGGTGGGCGG + Intronic
1049477091 8:142801842-142801864 TGGGTGGGTGAGTGGGTGGAAGG + Intergenic
1049554043 8:143273503-143273525 CGGGTGAGTGAGTGGCTGGCTGG + Intronic
1049565410 8:143335444-143335466 GGAGTGAGAGGCTGGTTGGCAGG - Intronic
1050004946 9:1119950-1119972 TGAGTGAGTGCCAGGGAGGTTGG + Intergenic
1051248616 9:15136831-15136853 TGAGTCAGTTCCTGGGTGGGAGG - Intergenic
1051495131 9:17712843-17712865 TGAGTGGGTGGGTGGGTGGGTGG - Intronic
1051495133 9:17712847-17712869 TGAGTGAGTGGGTGGGTGGGTGG - Intronic
1051495135 9:17712851-17712873 TGGATGAGTGAGTGGGTGGGTGG - Intronic
1052357809 9:27523957-27523979 TGAGTGAGTGAGTGAGTGCATGG + Intronic
1052569506 9:30201389-30201411 GGAGTGGGTGGATGGGTGGCAGG - Intergenic
1053055840 9:34992662-34992684 TGAGTCAGGGAATGGGTGTCTGG - Intronic
1053183345 9:35993098-35993120 TGAGTGAGTGAATGAATGGGTGG - Intergenic
1054166059 9:61730546-61730568 TGAAGGAGGGACTTGGTGGCAGG + Intergenic
1054459177 9:65453489-65453511 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1054462019 9:65470458-65470480 TGGGTGGGTGAATGGGTGGATGG + Intergenic
1055056616 9:72029981-72030003 TGGGTGAGTGGTTGGTTGGCTGG - Intergenic
1055180634 9:73381681-73381703 TGAGGGAGGGTCTGGGTGGGAGG - Intergenic
1055582472 9:77721681-77721703 TGGGTGGGTGCCTGGGTGGGTGG - Intronic
1055616123 9:78074728-78074750 TGAGTGAGTGAATGGATGAGGGG - Intergenic
1055641151 9:78319972-78319994 TGAATGAGTGAATGAGTGGATGG - Intronic
1055936790 9:81611608-81611630 TGAGTGTGTGGCTGGGAGACTGG + Intronic
1055964747 9:81854920-81854942 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1056106220 9:83349236-83349258 TGAATGACCGACTGGGAGGCAGG - Intronic
1056776887 9:89519411-89519433 TGGGTGAGTCACCGGATGGCTGG + Intergenic
1057213074 9:93211412-93211434 TGGGTGAGTGAATGAGTGGTGGG - Intronic
1057213092 9:93211562-93211584 TGAGTGAGTGAATGTGTGAGTGG - Intronic
1057213102 9:93211646-93211668 TGAGTGAGTGAATGAGTGGGTGG - Intronic
1057273208 9:93662300-93662322 TGATTGAGTGAGTGGATGGGTGG + Intronic
1057310003 9:93936647-93936669 TGACTGAGTGACTGACTGACTGG - Intergenic
1057310010 9:93936771-93936793 TGACTGACTGACTGACTGGCTGG - Intergenic
1059365508 9:113783717-113783739 TGATTGAGTGAGTGGATGGATGG + Intergenic
1059454320 9:114390033-114390055 TGAGTGAGTGACAGGGTGTCAGG - Intronic
1059566905 9:115391654-115391676 TGAGTGCATGACTCGCTGGCTGG - Intronic
1060007871 9:120016404-120016426 TGAGGGAGGGGCTGGGTGGGAGG - Intergenic
1060306380 9:122416554-122416576 TGAGTCAGTTCCTGGGTGGGGGG + Intergenic
1060523371 9:124307306-124307328 TGACTGGGAGACTGGGGGGCAGG - Intronic
1060664972 9:125427437-125427459 TGAATGAATGAATGGGTGGGCGG - Intergenic
1060889128 9:127177181-127177203 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1061159233 9:128883574-128883596 GGGATGAGTGACTGGGTGGCTGG + Intronic
1061387576 9:130299587-130299609 TGAGTGGATGAATGGGTGGGTGG - Intronic
1061387600 9:130299703-130299725 TGAGTGAATGGGTGGGTGGATGG - Intronic
1061387601 9:130299707-130299729 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1061387612 9:130299739-130299761 TGAGTGAATGGGTGGGTGGATGG - Intronic
1061387613 9:130299743-130299765 TAGGTGAGTGAATGGGTGGGTGG - Intronic
1061387630 9:130299835-130299857 TGAGTGAATGGGTGGGTGGATGG - Intronic
1061387631 9:130299839-130299861 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1061387637 9:130299859-130299881 TGAGTGAATGGGTGGGTGGATGG - Intronic
1061387638 9:130299863-130299885 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1061387657 9:130299955-130299977 TGAGTGAGCGGGTGGGTGGATGG - Intronic
1061387658 9:130299959-130299981 TGGGTGAGTGAGCGGGTGGGTGG - Intronic
1061402100 9:130373977-130373999 TGGGTGGGTGAATGGGTGGATGG + Intronic
1061448626 9:130656412-130656434 TGAGTGAATGACAGGGTAGATGG - Intergenic
1061716009 9:132519257-132519279 TGGATGAGTGAGTGGGTGGGTGG + Intronic
1061716010 9:132519261-132519283 TGAGTGAGTGGGTGGGTGGATGG + Intronic
1061810744 9:133161723-133161745 TGAATGAATGACTGCATGGCAGG - Intronic
1061846771 9:133392648-133392670 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061846798 9:133392756-133392778 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061846823 9:133392840-133392862 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061846905 9:133393144-133393166 TGAGTGAATGAGTGGGTAGGTGG + Intronic
1061847028 9:133393634-133393656 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061908857 9:133712432-133712454 TGAGGGGGTGGCTGGGGGGCAGG - Intronic
1061934837 9:133851725-133851747 TGGGTGAATGAATGGGTGGATGG + Intronic
1061938306 9:133870889-133870911 TGGGTGAGTGCGTGGGTGGGTGG + Intronic
1061938308 9:133870893-133870915 TGAGTGCGTGGGTGGGTGGGTGG + Intronic
1061938400 9:133871269-133871291 TAAGTGAGTGGGTGGGTGGATGG + Intronic
1062051979 9:134452118-134452140 TGGGTGAGTGAATGGGTGGATGG - Intergenic
1062051997 9:134452190-134452212 TGGGTGAGTGAATGGGTGGTTGG - Intergenic
1062089686 9:134668983-134669005 TGAGTGGGTGGGTGGGTGGATGG - Intronic
1062089687 9:134668987-134669009 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1062112622 9:134790410-134790432 TGGGTGGGTGGCTGGATGGCTGG - Intronic
1062153724 9:135034306-135034328 GGAGAGAGTGATGGGGTGGCGGG - Intergenic
1062163089 9:135090501-135090523 TGAATGAGTGAAAGGGTGGATGG + Intronic
1062210600 9:135361732-135361754 TGAGTGGGTGGGTGGGTGGGTGG + Intergenic
1062247708 9:135577993-135578015 TGGGTGAGTGGATGGGTGGGTGG - Intergenic
1062247733 9:135578088-135578110 TGAGTGGGTGATTGAGTGGATGG - Intergenic
1062247775 9:135578327-135578349 TGGGTGGGTGAGTGGGTGGCAGG - Intergenic
1062247844 9:135578673-135578695 TGGGTGGGTGAGTGGGTGGCAGG - Intergenic
1062391674 9:136336369-136336391 GGAGTGAGTGACTGGGGGTGTGG - Intronic
1062443116 9:136581519-136581541 TGAGTGAGTGAGTGAGTGAATGG - Intergenic
1062443142 9:136582338-136582360 TGAGTGAGTGAATGAGTGAGTGG - Intergenic
1062649740 9:137569434-137569456 TGAGTGACTGGCTGGCTGGATGG - Intronic
1062649741 9:137569438-137569460 TGGGTGAGTGACTGGCTGGCTGG - Intronic
1062649785 9:137569599-137569621 TGGGTGAGTGGCTGGCTGGCTGG - Intronic
1203453748 Un_GL000219v1:145188-145210 TGAGTTCCTGACTAGGTGGCAGG - Intergenic
1185495307 X:550067-550089 TGGGTGAGTGGGTGGGTGGATGG - Intergenic
1185497493 X:566368-566390 TGAATGAGTGGATGGGTGGATGG + Intergenic
1185583266 X:1226938-1226960 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1185583307 X:1227122-1227144 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1185583467 X:1227952-1227974 TGAATGAATGAATGGGTGGATGG + Intergenic
1185583475 X:1227988-1228010 TGAGTGAGTGGGTGGGTTGATGG + Intergenic
1185616156 X:1423544-1423566 TGGGTGGGTGAGTGGGTGGATGG - Intronic
1185616405 X:1424580-1424602 TGGGTGAGTGGATGGGTGGCTGG - Intronic
1185624438 X:1472572-1472594 TGGGTGAGTGGGTGGATGGCTGG + Intronic
1185624551 X:1473030-1473052 TGAATGGGTGAGTGGGTGGGTGG + Intronic
1185624552 X:1473034-1473056 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1185624628 X:1473362-1473384 TGAATGGGTGAGTGGGTGGGTGG + Intronic
1185624630 X:1473366-1473388 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1185624631 X:1473370-1473392 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1185624733 X:1473805-1473827 TGAATGGGTGAGTGGGTGGGTGG + Intronic
1185624735 X:1473809-1473831 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1185624736 X:1473813-1473835 TGAGTGGGTGGGTGGGTGGATGG + Intronic
1185689210 X:2139453-2139475 TGAGTGAATGAATGGGTGAATGG - Intergenic
1185755476 X:2650004-2650026 TGAGTGAATGGCTGAGTGGATGG + Intergenic
1185843275 X:3413355-3413377 TGAGGGAGTGACCTGGTGGAAGG + Intergenic
1185874548 X:3691863-3691885 TGAATGACTGACTGGATGGATGG + Intronic
1185883196 X:3758879-3758901 TGAGTGAGTGGGTGGATGGATGG - Intergenic
1185883270 X:3759252-3759274 TGGGTGAGTGGATGGGTGGCTGG - Intergenic
1185883295 X:3759379-3759401 TGGGTGAGTGGATGGGTGGGTGG - Intergenic
1186209048 X:7230777-7230799 TGAGGGAGAGACTTGGTGGGAGG - Intronic
1186350213 X:8732254-8732276 CGTGTGAGTGACAGGGGGGCCGG + Intergenic
1186508872 X:10115958-10115980 TGGGTGGGTGGCTGGGTGGGTGG - Intronic
1186508908 X:10116058-10116080 TGGATGGGTGGCTGGGTGGCTGG - Intronic
1186660382 X:11663757-11663779 TGTGTGTGTGTTTGGGTGGCAGG - Intronic
1187225898 X:17375343-17375365 TGTGTGGGTGAGTGGGTGGGTGG - Intergenic
1189316929 X:40063080-40063102 GGAGGGGGTGACGGGGTGGCGGG + Intronic
1189686157 X:43565371-43565393 TGAGTGGGTGGCTGGGGGGTGGG + Intergenic
1190245335 X:48687068-48687090 TGAGTGGGTAAATGGGTGGTTGG + Intronic
1190245390 X:48687358-48687380 TGGGTGAGTGGATGGGTGGATGG + Intronic
1190504223 X:51110434-51110456 TGTGTGAGAGACTGTGTGGGGGG - Intergenic
1190873625 X:54444841-54444863 TGAGTGAGTGTGGGTGTGGCTGG + Exonic
1192710315 X:73575693-73575715 TGAGTGAGTGAGTGAGTGAGTGG + Intronic
1193542314 X:82787518-82787540 TGTGGGAGGGACTGGGTGGGAGG + Intergenic
1193929898 X:87541091-87541113 TGAGGGAGGGACTTGGTGGGAGG + Intronic
1194118123 X:89927182-89927204 AGAGTGAGGGGCTGGGTGGAGGG - Intergenic
1194265324 X:91746029-91746051 TGGGCGAGTGACTGGGAGGTGGG - Intergenic
1194332309 X:92599048-92599070 AGAGAAAGTGAGTGGGTGGCAGG + Intronic
1195202397 X:102564193-102564215 TGAGTGAGTGACAGAGAGACAGG - Intergenic
1197010601 X:121557915-121557937 TGAGTGAGTTGCTGAGTGGAAGG - Intergenic
1197809946 X:130432399-130432421 TGAGTAACTGAATGGCTGGCTGG - Intergenic
1199387020 X:147234816-147234838 TGAGTGGGTGGGTGGGTGGATGG - Intergenic
1200471003 Y:3584751-3584773 AGAGTGAGGGGCTGGGTGGAGGG - Intergenic
1200582475 Y:4966491-4966513 TGGGCGAGTGACTGGGAGGTGGG - Intergenic
1200641014 Y:5718099-5718121 AGAGAAAGTGAGTGGGTGGCAGG + Intronic
1200729130 Y:6713277-6713299 TGAGTCAGTCCCTGGGTGGGGGG + Intergenic
1200781581 Y:7221113-7221135 TGAGTGAGTGGATGGATGGATGG + Intergenic
1201231919 Y:11873224-11873246 TGAGAGAGTGACCTGGTGGAAGG - Intergenic
1201305892 Y:12550303-12550325 TGAGTGAGTGGATGGATGGATGG + Intergenic
1201579988 Y:15501099-15501121 TGAGGGAGAGACTTGGTGGGAGG - Intergenic
1201694303 Y:16807926-16807948 TGAGTCAGTCCCTGGGTGGGGGG - Intergenic