ID: 999452468

View in Genome Browser
Species Human (GRCh38)
Location 5:151688643-151688665
Sequence TTGAAGGACTGGAAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999452468_999452474 4 Left 999452468 5:151688643-151688665 CCAACTTCCTTCCAGTCCTTCAA No data
Right 999452474 5:151688670-151688692 CCCAAAGCTTCTCCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999452468 Original CRISPR TTGAAGGACTGGAAGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr