ID: 999454972

View in Genome Browser
Species Human (GRCh38)
Location 5:151707698-151707720
Sequence CAGCTGTTCTAAAACACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999454972_999454977 3 Left 999454972 5:151707698-151707720 CCATCTGTGTTTTAGAACAGCTG No data
Right 999454977 5:151707724-151707746 GGAACAGCTGTTGCCTCCCTGGG No data
999454972_999454976 2 Left 999454972 5:151707698-151707720 CCATCTGTGTTTTAGAACAGCTG No data
Right 999454976 5:151707723-151707745 AGGAACAGCTGTTGCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999454972 Original CRISPR CAGCTGTTCTAAAACACAGA TGG (reversed) Intergenic
No off target data available for this crispr