ID: 999458945

View in Genome Browser
Species Human (GRCh38)
Location 5:151741118-151741140
Sequence GACCCAGGGCTGCTGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999458945_999458953 9 Left 999458945 5:151741118-151741140 CCAGTCTCCAGCAGCCCTGGGTC No data
Right 999458953 5:151741150-151741172 TGCCCAATAAATGGCTAAAGTGG No data
999458945_999458951 0 Left 999458945 5:151741118-151741140 CCAGTCTCCAGCAGCCCTGGGTC No data
Right 999458951 5:151741141-151741163 CCCAGTAAGTGCCCAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999458945 Original CRISPR GACCCAGGGCTGCTGGAGAC TGG (reversed) Intergenic
No off target data available for this crispr