ID: 999460323

View in Genome Browser
Species Human (GRCh38)
Location 5:151752159-151752181
Sequence CTGAGCAATGCTGATCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999460313_999460323 13 Left 999460313 5:151752123-151752145 CCACCAGTAACTCTGACAGGGAT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 999460323 5:151752159-151752181 CTGAGCAATGCTGATCTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 130
999460315_999460323 10 Left 999460315 5:151752126-151752148 CCAGTAACTCTGACAGGGATGGG 0: 1
1: 0
2: 0
3: 5
4: 121
Right 999460323 5:151752159-151752181 CTGAGCAATGCTGATCTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999460323 Original CRISPR CTGAGCAATGCTGATCTGGT GGG Intronic
901129729 1:6954790-6954812 CTGAGCACAGCTGAGCTGGCGGG + Intronic
901210326 1:7520849-7520871 CTGAGGAAGGCTGGTCTGGAAGG - Intronic
912374798 1:109201376-109201398 CTGAGCAATTCTGAGCTGGGAGG + Intronic
912524517 1:110271233-110271255 CTGAGCACTGATGGTGTGGTTGG + Intronic
912663693 1:111560062-111560084 CTGAGCATTGCTTATGTGTTAGG + Intronic
914426970 1:147586573-147586595 GTGAGCAATTCTGATTTGGCGGG + Intronic
922274344 1:224063014-224063036 CTGAGCAATTCTGATTTGCTGGG + Intergenic
1064475023 10:15678765-15678787 CTAGGCAATGCTGATCCGGAAGG - Exonic
1065482606 10:26210874-26210896 GTGAGCCATGCAGATCTCGTGGG - Intronic
1067271035 10:44791441-44791463 CTGAGCAATCCTGAGTGGGTTGG + Intergenic
1074745272 10:116525575-116525597 TTGAGAGATGCTGATCTGGATGG - Intergenic
1076106922 10:127830972-127830994 CTCAAAACTGCTGATCTGGTGGG + Intergenic
1076202463 10:128569451-128569473 CTGAGCTATGTTAATCAGGTGGG - Intergenic
1076252989 10:128997698-128997720 CTGGGCAATGCTGGGCTGTTTGG - Intergenic
1077029435 11:457596-457618 CTGAGCCATGCTCCGCTGGTCGG + Intronic
1077112854 11:869557-869579 CTGAGCCAGGCTGTCCTGGTGGG + Exonic
1078201476 11:9187898-9187920 CTGATGAATTCTGATTTGGTGGG + Intronic
1085252537 11:75153097-75153119 CTGAGCAAAGGTGAACAGGTGGG - Intronic
1090227116 11:125078340-125078362 CTCAGAAATGCTCATCTGGATGG - Intronic
1093428729 12:19058861-19058883 CAGTGCAATGCTGATTTGGTGGG - Intergenic
1111564642 13:89999037-89999059 CTCAGAAATGCTGTTCTGGGTGG + Intergenic
1112609932 13:100946164-100946186 CTGAGCAAGGTGGATGTGGTAGG - Intergenic
1113437425 13:110304207-110304229 CTGGGCGATGCTGCTCTTGTTGG + Intronic
1114198417 14:20499918-20499940 CTGAACAATGCTTTTCTTGTGGG - Intergenic
1115472414 14:33782238-33782260 CTGAGCAATGGAGAACTGGAGGG - Intronic
1115617920 14:35113831-35113853 CTGGGCAAAGCAGATCAGGTAGG - Intronic
1117772879 14:59152147-59152169 TTGAGAAATACTGATCTAGTGGG - Intergenic
1119617333 14:76107479-76107501 CTGGGCAATGGTAATCTGGGAGG + Intergenic
1120852705 14:89185855-89185877 ATGAGCAGTGCTGCTCTGTTTGG - Intronic
1120867144 14:89305087-89305109 CTGAGCCCGGCTGATCTGGAGGG + Intronic
1122738229 14:103855900-103855922 CTGGGCACTGGGGATCTGGTGGG - Intergenic
1123063276 14:105604040-105604062 CTGAGCCAAGCTTAGCTGGTTGG - Intergenic
1123087338 14:105722826-105722848 CTGAGCCAAGCTTAGCTGGTTGG - Intergenic
1127319785 15:57831789-57831811 CTGAGCACTGCTGATATTGTGGG - Intergenic
1135526066 16:23214651-23214673 CTGAGGACTGGTAATCTGGTAGG + Intronic
1135682427 16:24469380-24469402 CTTAGAATGGCTGATCTGGTTGG + Intergenic
1138443815 16:57050712-57050734 CTGAACAATGATGAGCTGGTTGG + Intronic
1138707626 16:58933781-58933803 CTCAGCAATGCTGATTTAATTGG - Intergenic
1140803170 16:78507656-78507678 AGGTGCAATGCTGATCTGGCTGG - Intronic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1143870799 17:9956260-9956282 CAGAGGAAAGCTGATCTGGGAGG + Intronic
1145820009 17:27825051-27825073 TTGAGAAATGCTGATGTCGTGGG - Intronic
1145984176 17:29033349-29033371 CTGAGCAATTCAGTGCTGGTGGG + Intronic
1146799369 17:35806254-35806276 CAGAGCAATGCAGACCTGGGAGG + Intronic
1147344027 17:39775343-39775365 GTGAGAGATGCTGATCTTGTAGG - Intronic
1148471610 17:47896808-47896830 CCGAGCAGTGCCCATCTGGTTGG - Intronic
1152291596 17:79442980-79443002 CTGACCAATGCCGAGCTGCTGGG - Intronic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1152453195 17:80396745-80396767 CTGACCAAAGTTGCTCTGGTTGG - Exonic
1155270049 18:24132001-24132023 TTGTGCAATGATGTTCTGGTTGG + Intronic
1156420397 18:36946432-36946454 CTGAGTAATGCTGATGTTGCTGG - Intronic
1162183296 19:8885622-8885644 GTGAGCAATTGTGATGTGGTTGG - Intronic
1163384490 19:16991146-16991168 CTTAGCAATGCTCAGCTTGTGGG + Intronic
1166122651 19:40694670-40694692 CTGAGAAATGCTGCTCTAATGGG + Intronic
927113365 2:19879724-19879746 CTGAGGCATGGTGATCAGGTTGG - Intergenic
927864008 2:26577273-26577295 CATAGCAAAGCTGGTCTGGTGGG + Intronic
929924271 2:46196152-46196174 CTGAGCAAGGCTGGGCTGGCGGG + Intergenic
930215566 2:48692785-48692807 CTGAGGAATGGCTATCTGGTGGG + Intronic
932805459 2:74779002-74779024 CTCAGCTCTGCTGCTCTGGTGGG + Intergenic
932864402 2:75326365-75326387 CTGAGCAATGATGGTGAGGTTGG - Intergenic
933044751 2:77521620-77521642 CTGAGCAAAGCTGATCCTCTTGG - Intronic
941427494 2:165367354-165367376 CTGAGCAGTGGGGCTCTGGTAGG + Exonic
941876227 2:170436226-170436248 ATGAGCAATGCTTAGCTGGGAGG + Intronic
943934680 2:193901199-193901221 CTGAGGAGTGGAGATCTGGTAGG - Intergenic
946442115 2:219705245-219705267 CCTAGCAATCCTGATTTGGTGGG + Intergenic
1169682478 20:8231212-8231234 CTGAGAAATGCTGATCTAAATGG - Intronic
1170213186 20:13865874-13865896 CTGAGCACTGCTGCTCTGCGAGG + Intronic
1171279551 20:23884179-23884201 CTGAGCAATGCAGACCTGGCAGG - Intergenic
1173035230 20:39402547-39402569 CTGAGCAACACTGATCTAGGCGG + Intergenic
1173419028 20:42884242-42884264 TTGAGCATTTCAGATCTGGTGGG - Intronic
1173832774 20:46102584-46102606 CAGAGCTATGCTGACATGGTAGG - Intergenic
1174107747 20:48174864-48174886 GCTGGCAATGCTGATCTGGTAGG + Intergenic
1174167427 20:48594972-48594994 CTGGGCTTTGCTGAGCTGGTAGG + Intergenic
1174311667 20:49660625-49660647 CTGTGCAATGCTCATGTAGTTGG + Intronic
1176193543 20:63825565-63825587 TGGAGCAAGGCTGTTCTGGTTGG - Intronic
1178281932 21:31291154-31291176 CTGAGAAATGCAGTTATGGTTGG - Intronic
1181337688 22:22153152-22153174 TTGAGTAATGCTGATTTGATGGG + Intergenic
1183755134 22:39754817-39754839 ATGTGAAATGCTGATCTGGCCGG - Intronic
1184217229 22:43075891-43075913 CTGAGAAACCCTGGTCTGGTGGG + Intronic
1184677764 22:46053046-46053068 CTGAGCAATGGTGAGCTGCCCGG + Intronic
949128417 3:472981-473003 CTGAATAAAGGTGATCTGGTAGG + Intergenic
949675368 3:6447470-6447492 CTGAGCACTTCTGAGCTGGTAGG + Intergenic
953234255 3:41092341-41092363 CTGAAAAATACTGATATGGTGGG + Intergenic
954634138 3:52062440-52062462 CAGAGCAATGGGGATCTGCTGGG + Intergenic
956017992 3:64904521-64904543 CTCAGCAATGCTGATATTTTCGG - Intergenic
962929975 3:140027125-140027147 CAGAGCAAAACTGATCTGGCAGG + Intronic
967089009 3:186119247-186119269 CTGGGCAATAGTGATCAGGTTGG + Intronic
971310063 4:25517974-25517996 TTGAGAACTGCTGATCTGGTTGG + Intergenic
973396131 4:49594580-49594602 CAGAGCACTGCTGCTGTGGTCGG + Intergenic
973396451 4:49597393-49597415 CAGAGCACTGCTGCTGTGGTCGG + Intergenic
974392787 4:61294414-61294436 CTAAGCTATGGTGTTCTGGTGGG + Intronic
974819003 4:67042635-67042657 CTAAGCTATGATGTTCTGGTAGG - Intergenic
975168866 4:71210179-71210201 CTGAGCACTGCTGGTATTGTAGG + Intronic
976904979 4:90226216-90226238 CTGAGCAAGGCTCAGCTGGCTGG - Intronic
978104493 4:104884784-104884806 CTGATCAGTGCTGTTCTGGAAGG + Intergenic
980300257 4:130981992-130982014 CTGTTCAATGCTGATATGATTGG - Intergenic
982228369 4:153186156-153186178 CTGGGCACTGCTGATGTTGTGGG - Intronic
984028518 4:174574136-174574158 ACAAGCAATGCTGATATGGTGGG - Intergenic
986340235 5:6782860-6782882 CTGATGAATGCTGTACTGGTAGG + Intergenic
987513429 5:18873538-18873560 CAGATGAAGGCTGATCTGGTAGG - Intergenic
992012771 5:72545848-72545870 CAGAGTAATTCTGATCTTGTAGG + Intergenic
999348655 5:150846159-150846181 CTGAGCCTAGCTAATCTGGTGGG + Intergenic
999460323 5:151752159-151752181 CTGAGCAATGCTGATCTGGTGGG + Intronic
1000705454 5:164505126-164505148 CTGCAGAATCCTGATCTGGTAGG + Intergenic
1001317173 5:170652055-170652077 CTGAGCAATGAGGAGCTGGCTGG + Intronic
1001831315 5:174791489-174791511 CTGAGAAATGCTGATTCTGTAGG - Intergenic
1003654405 6:7992457-7992479 CTGAGCTTTGCTGCTCTGGCAGG + Intronic
1011226134 6:85109320-85109342 CTGATAAATGGTGATCTGCTGGG - Intergenic
1014948271 6:127522757-127522779 CTGAGAAAAGCTGATGTGTTTGG + Intronic
1018169957 6:161136828-161136850 CAAAGCAAGGCTGCTCTGGTGGG + Intronic
1021566973 7:22025705-22025727 TGGAGCAATGGTGAGCTGGTGGG - Intergenic
1022474473 7:30700983-30701005 CTGAGCAGTGCTGTTCTTGGCGG + Intronic
1023867004 7:44243051-44243073 GTGAGCAATTCTAATCTGGGTGG + Intronic
1024331603 7:48160690-48160712 CTGAGCAAAGAGCATCTGGTGGG - Intergenic
1024471224 7:49770322-49770344 CTGAGCAATGCAGAGCAAGTGGG - Intergenic
1024550428 7:50558538-50558560 TTGAGCACTGCTGATTTGTTTGG - Intronic
1025205644 7:56992079-56992101 CTGAGCCATGCTCCTGTGGTCGG + Intergenic
1025666296 7:63584859-63584881 CTGAGCCATGCTCCTGTGGTCGG - Intergenic
1030226647 7:107159203-107159225 ATGAGCAATGCTAAGTTGGTGGG - Intronic
1030344415 7:108416136-108416158 CTTAGTCATGCTGATCTGGAGGG - Intronic
1034875166 7:154719260-154719282 CAGAGCAATGATGTTCTGCTGGG + Intronic
1034998679 7:155594419-155594441 CTGGGCACTGCTGGTCTGGGTGG - Intergenic
1036142427 8:6220563-6220585 CTAAGCAATACTGAACTGGGAGG + Intergenic
1038700845 8:29847965-29847987 CTGAGATATGGTGATCTGCTGGG - Intergenic
1038778887 8:30554317-30554339 TTGAGAAATGCTGGTCTGGAAGG - Intronic
1041295255 8:56350581-56350603 CTGAGTAATGCTGGTCTCATAGG + Intergenic
1041321414 8:56618083-56618105 CCTTGCAATGCTGTTCTGGTTGG + Intergenic
1041564715 8:59263413-59263435 CTGAGCACTGATGATCTGTCTGG + Intergenic
1046839915 8:118844785-118844807 CTCAGAAATTCTGATTTGGTTGG - Intergenic
1047406608 8:124590599-124590621 CTGAATGATGCTGATCTGCTTGG + Intronic
1050824462 9:9928433-9928455 TTGAACAATGCTGATTTGATGGG + Intronic
1055679220 9:78697362-78697384 CTGAGCTAGGCTGTGCTGGTGGG - Intergenic
1057313051 9:93953569-93953591 CGCAGCAAGGCTGATTTGGTTGG - Intronic
1186227125 X:7411671-7411693 CTGAGAGATGCTGAGCTGGAGGG - Intergenic
1192185028 X:68940926-68940948 CAGAGCACAGCTGAGCTGGTAGG - Intergenic
1192261772 X:69509995-69510017 CTGAGCAACTCTGATATGGCAGG - Intronic
1192590371 X:72354819-72354841 ATGACAAATGCTGACCTGGTTGG + Intronic
1193714809 X:84926014-84926036 CTTAACAAGGCTGATCTGGCTGG - Intergenic
1197604406 X:128567769-128567791 ATTAGCAATGTAGATCTGGTGGG - Intergenic