ID: 999462697

View in Genome Browser
Species Human (GRCh38)
Location 5:151771067-151771089
Sequence GGGCGCTGCGAGGCGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 330}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999462697_999462710 24 Left 999462697 5:151771067-151771089 CCCGCGGCCGCCTCGCAGCGCCC 0: 1
1: 0
2: 2
3: 39
4: 330
Right 999462710 5:151771114-151771136 CGCACTCTCAGGCCTTCCACCGG 0: 1
1: 1
2: 0
3: 11
4: 96
999462697_999462701 -7 Left 999462697 5:151771067-151771089 CCCGCGGCCGCCTCGCAGCGCCC 0: 1
1: 0
2: 2
3: 39
4: 330
Right 999462701 5:151771083-151771105 AGCGCCCGCCAAGAAGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 59
999462697_999462705 0 Left 999462697 5:151771067-151771089 CCCGCGGCCGCCTCGCAGCGCCC 0: 1
1: 0
2: 2
3: 39
4: 330
Right 999462705 5:151771090-151771112 GCCAAGAAGCGCCTGGCGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 96
999462697_999462709 13 Left 999462697 5:151771067-151771089 CCCGCGGCCGCCTCGCAGCGCCC 0: 1
1: 0
2: 2
3: 39
4: 330
Right 999462709 5:151771103-151771125 TGGCGGAAGGGCGCACTCTCAGG 0: 1
1: 0
2: 1
3: 2
4: 66
999462697_999462707 1 Left 999462697 5:151771067-151771089 CCCGCGGCCGCCTCGCAGCGCCC 0: 1
1: 0
2: 2
3: 39
4: 330
Right 999462707 5:151771091-151771113 CCAAGAAGCGCCTGGCGGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 76
999462697_999462702 -4 Left 999462697 5:151771067-151771089 CCCGCGGCCGCCTCGCAGCGCCC 0: 1
1: 0
2: 2
3: 39
4: 330
Right 999462702 5:151771086-151771108 GCCCGCCAAGAAGCGCCTGGCGG 0: 1
1: 0
2: 1
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999462697 Original CRISPR GGGCGCTGCGAGGCGGCCGC GGG (reversed) Intronic
900091971 1:924570-924592 GCGGGCAGCGAGGCGGCCGGGGG - Intergenic
900110111 1:1001727-1001749 GGGGGCTGCGAGGCCGGAGCGGG + Intergenic
900226421 1:1535423-1535445 AGGCCCTTCGAGGAGGCCGCCGG - Exonic
900308300 1:2021570-2021592 GTGTGCTGCGTGGCGGCCGTGGG + Intronic
900367830 1:2318453-2318475 AGGAGTGGCGAGGCGGCCGCAGG - Intergenic
900493129 1:2962765-2962787 GGGCGCTGGGAGGGGGCAGGAGG + Intergenic
903016786 1:20366680-20366702 GGTCGCGGCGCGGCGTCCGCGGG - Intergenic
903354285 1:22736774-22736796 GCGCACTGTGGGGCGGCCGCAGG + Intronic
903379876 1:22889277-22889299 GGGAGATGAGAGGCGGCTGCTGG - Intronic
903777055 1:25800130-25800152 GGGAGGGGCGGGGCGGCCGCAGG - Intergenic
904822654 1:33255958-33255980 TGGGGTGGCGAGGCGGCCGCCGG + Intergenic
905166146 1:36084379-36084401 GGGAGCTGGGGGGCGGCCCCCGG - Intronic
905580774 1:39081633-39081655 GGGAGCTGGGGCGCGGCCGCCGG - Intronic
905639178 1:39576779-39576801 GGGCGGAGAGAGGCGGCCGAGGG + Intronic
905807935 1:40890479-40890501 GGGCTCTGCGAGGCTGCCCCTGG - Intergenic
906214383 1:44030524-44030546 GGGCGGGGCCGGGCGGCCGCAGG - Intronic
906315518 1:44784403-44784425 GGGGTCTGCGCGGCGGGCGCGGG + Exonic
906962650 1:50427803-50427825 GGGCGCTGCGAATCGGCTCCTGG + Intergenic
909232294 1:73105927-73105949 GGACGCAGCGAGGCAGCTGCAGG + Intergenic
909433529 1:75615926-75615948 GGGAGCTGCGCGGCAGCCGGAGG - Intergenic
911618363 1:100038635-100038657 GGGCGCGGCGGGCGGGCCGCCGG - Intronic
915626311 1:157115995-157116017 GGGAGCTGGGAGGAGGCCCCTGG + Intergenic
916694551 1:167221760-167221782 GGGCGCTGCGAGGTGGCCTGGGG + Intronic
917788881 1:178487018-178487040 GGGCCCTGCGAGGCGCCCACGGG + Intergenic
919724553 1:200873330-200873352 CGGCGGCGCTAGGCGGCCGCTGG + Exonic
919980873 1:202642487-202642509 GGGCGATGGGAGGGGGCAGCTGG - Intronic
920074717 1:203327666-203327688 GGGCGAGGCGGGGCGGCCGTTGG + Intergenic
921325425 1:213983131-213983153 GGGCACTGGGAGGAAGCCGCGGG + Intergenic
922315059 1:224434626-224434648 GGGCGCCGCGGGGCGGCTGCGGG + Intronic
922677883 1:227563840-227563862 GGGCGGGGCCAGGCCGCCGCGGG + Intronic
922730961 1:227948418-227948440 GGGCGCTGCGCGGCTGCTCCGGG + Intergenic
924198951 1:241640176-241640198 GGGCGCTGAGGGGCCGGCGCCGG - Exonic
1063123342 10:3120057-3120079 GCGCCCTGCCAGGCGGGCGCCGG + Intronic
1064354361 10:14604176-14604198 GGGCGCGGGGAGGCGGGCGGCGG - Intronic
1065188725 10:23192407-23192429 GGGGGCAGCTAGGCGGCCGCCGG - Exonic
1066460524 10:35608514-35608536 GGGCGCGGCCAGGCGGCTGGGGG - Exonic
1067980008 10:51074220-51074242 GGGGGCTCCGAGGCAGCGGCTGG - Exonic
1068544937 10:58334929-58334951 GGGCGCGGCGGGGAGGGCGCAGG + Intergenic
1069486646 10:68827896-68827918 GGAAGCCGCGCGGCGGCCGCAGG - Exonic
1069486733 10:68828232-68828254 GGAAGCCGCGCGGCGGCCGCAGG - Intronic
1069709373 10:70479003-70479025 GGGCGCAGCACGCCGGCCGCAGG + Exonic
1071966588 10:90858087-90858109 GGACGCGGCGCGGCTGCCGCAGG - Intergenic
1072723470 10:97796069-97796091 GGGCGCTGAGAGCAGGGCGCTGG - Intergenic
1072731598 10:97850274-97850296 GGGCGCTCGGAGGCTGTCGCGGG - Exonic
1072757558 10:98030836-98030858 CGGCGCGGCGCGGCGGCCACTGG + Intergenic
1073043275 10:100621587-100621609 CGGGGCGGCGGGGCGGCCGCCGG + Intergenic
1073441431 10:103555121-103555143 GGGAGCGGGGAGGCGGCGGCCGG + Intronic
1074140813 10:110671065-110671087 GGGGGCTTCGAGGCAGCCACAGG - Intronic
1075032173 10:119030626-119030648 TGGCGCTGCGGGGCGGCGGGCGG - Exonic
1076149356 10:128150074-128150096 GGGCGCTGCGGGGCGCCGGCTGG - Intergenic
1076825338 10:132964450-132964472 GAGCGCAGGGAGGCGGCCGCAGG - Intergenic
1077066056 11:641333-641355 GGGAGCAGGGAGGCGGCAGCGGG + Intergenic
1078561733 11:12378071-12378093 GGGCGCCGCTTGGCGGCCGGAGG + Intronic
1079126489 11:17721446-17721468 GGGCACTGCGGGGCGGCGTCCGG - Exonic
1082811873 11:57483191-57483213 CGGCGCTGCGTGGCTGCGGCTGG - Intergenic
1084000199 11:66291931-66291953 GAGGGCTGCGACGCGGCCCCCGG - Exonic
1084225422 11:67712036-67712058 GTGCGAAGCGAGGCGGCCGCGGG - Intergenic
1084263241 11:67991886-67991908 GTGCGGGGCGAGGCGGCCGCGGG - Intronic
1084779226 11:71397678-71397700 GGGGGCTGCTGGGCTGCCGCTGG - Intergenic
1084942066 11:72618237-72618259 GGGCGCTGCGAAGAGGCCTGAGG - Intronic
1085043971 11:73342954-73342976 GAGCGCTGCGGCCCGGCCGCCGG - Intronic
1088604202 11:111512773-111512795 GTGCGCTGCGAGGCCGGCGGGGG + Intergenic
1088892982 11:114059374-114059396 GGCCGGTGAGAGGCGGCCGCCGG + Intergenic
1090013256 11:123062912-123062934 GGGAGCCGCCAGGCCGCCGCGGG + Intronic
1090280073 11:125448321-125448343 GGGTGTTGCCAGGAGGCCGCAGG - Intronic
1090799152 11:130159915-130159937 GGGCCATGGGAGCCGGCCGCCGG + Exonic
1090968268 11:131617088-131617110 GGACGCTGCGAGGCTGGGGCAGG + Intronic
1091225871 11:133956335-133956357 CAGCTCTGGGAGGCGGCCGCCGG + Intronic
1091286568 11:134411766-134411788 GTGCGCGGCGGGGCGCCCGCGGG + Intronic
1091488925 12:916301-916323 GGGCCCTGGGAGGCGTCTGCAGG - Intronic
1091549947 12:1529982-1530004 GGGCGCCCCGAGGGGGCTGCTGG + Intronic
1091594369 12:1865746-1865768 GGGCGCGGGGAGGCGGTTGCGGG + Intronic
1091665429 12:2415380-2415402 GGGCGCTGCGCGGCCTCCACGGG - Intronic
1092278489 12:7081162-7081184 GGGCCCTGCTGGGCGACCGCTGG - Exonic
1092743263 12:11649948-11649970 GGGCGGGGCGGGGCGGCCGGCGG - Exonic
1092783916 12:12010942-12010964 GGGGGCTGCGAGGGGGTCGCTGG + Intergenic
1095349192 12:41188895-41188917 GGGGGCCGCCGGGCGGCCGCTGG + Exonic
1096464359 12:51840138-51840160 GGGCACTGCGGGGAGGGCGCAGG + Intergenic
1096478599 12:51923606-51923628 TGGGGATGGGAGGCGGCCGCTGG - Intergenic
1096786056 12:54017989-54018011 CGGCGCAGCTAGGCGGCCGGCGG + Intronic
1097155105 12:57006556-57006578 GGGCGCTGCGGGCCGGGCGGCGG - Intergenic
1099439768 12:82686574-82686596 AGGCGCTGCCAGGCAGCAGCGGG + Intergenic
1100539927 12:95548475-95548497 GGGCACTCTGAGGCTGCCGCCGG + Intronic
1101773826 12:107775762-107775784 GCGCGCTGTGCGGCGGGCGCGGG - Exonic
1103488228 12:121296858-121296880 GGGCGGTGCGCGGCGGGCGCGGG - Intronic
1103516093 12:121509425-121509447 GGGCGCTGCGAGGGGGCTTCTGG - Intronic
1103925379 12:124420932-124420954 GGGGGCTCCCAGGCGGCCCCAGG + Intronic
1104568297 12:129903952-129903974 GGGCGGGCCGAGGCGGCGGCCGG - Intergenic
1105004078 12:132710493-132710515 GGGAGCTGGGAAGCTGCCGCAGG - Intergenic
1105472133 13:20703886-20703908 GGGCGAGGGGAGGCGCCCGCCGG + Intronic
1107548940 13:41457650-41457672 GGGTCCTGCGAGGTGGCAGCCGG - Exonic
1107603838 13:42040257-42040279 GGGCGCTGGGAGGCGTCTCCCGG + Intronic
1108029250 13:46211860-46211882 AGGCGAGGCGAGGCGGGCGCCGG - Intronic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1111676865 13:91398925-91398947 GAGCGGTGCGAGCCGGCTGCGGG - Exonic
1113727828 13:112618262-112618284 GGGCACTGAGTGGCGGCCTCTGG - Intergenic
1113737771 13:112690357-112690379 GGGCGCGCCGAGCCGGGCGCGGG + Exonic
1114312021 14:21476696-21476718 GGGCGGTTCGGGGCGGCCGGGGG - Intronic
1115610706 14:35046380-35046402 GCGCGGCGCGAGGCGGGCGCTGG + Intronic
1119310797 14:73644872-73644894 TGGGACTGCGTGGCGGCCGCCGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1120881296 14:89417011-89417033 GGGCGGCGGGGGGCGGCCGCGGG + Intronic
1120901062 14:89575860-89575882 AGGCGCTGCGTGGAGGCCGGAGG - Intronic
1121343412 14:93118034-93118056 GGGCGCTGGGAGGCCGAAGCAGG + Intergenic
1122217684 14:100214648-100214670 GGGCGGGGCTAGGCGGGCGCGGG - Intergenic
1122418403 14:101561075-101561097 CGGCGCGGCTCGGCGGCCGCCGG + Intergenic
1122418417 14:101561112-101561134 GTGCGCGGCGAGGGGGGCGCGGG + Intergenic
1122444896 14:101761433-101761455 AGTCGCTGCGAGCCGGCCTCAGG - Intergenic
1122517663 14:102319954-102319976 GGACGCGGCGCGGCGGCTGCGGG + Exonic
1122788245 14:104173744-104173766 GGCAGCTGTGAGGCGGCGGCTGG + Exonic
1123684514 15:22787257-22787279 CGGCGCTTCCAGGCGGGCGCTGG - Intronic
1124922285 15:34038816-34038838 GCGCCCCGCGAGGCAGCCGCCGG - Exonic
1125503199 15:40252305-40252327 GGTCTCCGCGAGGCGGCCACTGG + Exonic
1125589325 15:40844577-40844599 GGCCGGGGCGAGGCGGGCGCGGG - Exonic
1125684734 15:41557747-41557769 GGGCGCCCCCAGGCGGCAGCAGG - Intronic
1127753591 15:62068504-62068526 GCGCGGTGCCCGGCGGCCGCAGG - Exonic
1127868248 15:63048753-63048775 GGGCCCTGCGGGGCTGCCCCGGG - Intronic
1128582152 15:68818130-68818152 GGGCGCTGGCAGGCGGGCGGCGG - Intronic
1128866017 15:71115652-71115674 AGGCGAGGCGAGGCGGCCGCCGG + Intronic
1130224594 15:82047125-82047147 GGGCGCTGCGGAGCGCGCGCCGG + Intergenic
1130894339 15:88158728-88158750 GGGCGCTGCCAGGCAGATGCTGG + Intronic
1132186576 15:99806561-99806583 GGGAGCTGCGCGGCGGCCTCGGG - Intergenic
1132429110 15:101746150-101746172 GGGAGCTGCGCGGCGGCCTCGGG + Intergenic
1132549943 16:550225-550247 GGGCACTCCGAGGAGGCCCCTGG - Intronic
1132741265 16:1414499-1414521 AGGCGCTGCGCGGAGGCCGGGGG + Intronic
1132947250 16:2538296-2538318 GGGCGCTGCTTGGCTGCGGCGGG + Intronic
1132968465 16:2673160-2673182 GGGCGCTGCTTGGCTGCGGCGGG - Intergenic
1133319674 16:4905142-4905164 GGGCACTCAGAGCCGGCCGCCGG + Intronic
1135976149 16:27109951-27109973 GGGCGCGGCGGGGCGGGAGCGGG - Intergenic
1136102996 16:28009221-28009243 GGGAGCTGCGAGGAAGCCACAGG - Intronic
1136453963 16:30370110-30370132 GGCGGCGGCGAGGGGGCCGCGGG + Exonic
1138497296 16:57416270-57416292 GGGTCCTGGGAGGCGGCCGCTGG + Intergenic
1139559732 16:67734455-67734477 GGGCCCTGTGAGGTGGCCTCAGG + Intronic
1140420822 16:74817431-74817453 GGGCACTGCCAGGCGGGTGCTGG + Intergenic
1141601081 16:85126806-85126828 GGGAGCTGCCAGGCGGCAGGGGG + Intergenic
1142409525 16:89908714-89908736 GGGAGCTGGGAGGCGGGAGCCGG - Intronic
1142409552 16:89908798-89908820 GGGAGCTGCGAGGTGGGAGCTGG - Intronic
1142409559 16:89908826-89908848 GGGAGCTGCGAGGTGGGAGCTGG - Intronic
1142509830 17:386259-386281 GGGCGGGGCGGGGCGGGCGCCGG - Intergenic
1142695156 17:1629222-1629244 GGGGACGGCGGGGCGGCCGCGGG - Intergenic
1142697898 17:1643703-1643725 GCGCGCTGCGAGCAGGCCACGGG - Exonic
1142699147 17:1649103-1649125 GGGCGGAGCGAGGCAGGCGCTGG - Intronic
1142812013 17:2399866-2399888 GGGCGCAGCGAGGGGGGCCCGGG + Intronic
1143248585 17:5505438-5505460 GGGCGCTGTGAGGTGGCACCTGG + Intronic
1145011351 17:19370112-19370134 GGGCGATGGGAGGTGGCCGTCGG - Intronic
1147325570 17:39667977-39667999 GGGCGCTGCGAGGGGGAAACTGG + Intronic
1147907552 17:43832917-43832939 GCGCGCGGCGGGGCGGGCGCGGG + Intronic
1148555795 17:48577950-48577972 GGGCGCAGGGAGGCGGCGGGGGG + Exonic
1148758722 17:49988180-49988202 GGGAGCAGCGAGGCGGCAGCCGG - Intergenic
1149685459 17:58532104-58532126 GGGCGGAGCGAGTCGGCCCCGGG + Intronic
1149995813 17:61405453-61405475 GGGCGCAAGGAGGCGGCCGAGGG + Exonic
1150283947 17:63945155-63945177 GGGCTCTGGCAGGCGGCCTCTGG - Intronic
1150485040 17:65537549-65537571 GCGCCCGGCGAGGCGGCCGCGGG + Exonic
1150489006 17:65561689-65561711 GGGCGGGGCGGGGCGGGCGCGGG - Intronic
1150640705 17:66947640-66947662 GGGCCCTGCCAGGCTGCAGCTGG - Intergenic
1150692752 17:67378873-67378895 GGGGGCTGCGACGCGGCCACAGG + Intronic
1151102041 17:71566987-71567009 GGGTGCTTGGAGGTGGCCGCCGG - Intergenic
1151559171 17:74861555-74861577 GGGCGCGGCGGGGCGGGGGCGGG + Intergenic
1151696604 17:75721272-75721294 GGGCGCTGGGCGGGCGCCGCGGG + Intergenic
1151812529 17:76452966-76452988 AGGCGCTGCGAGCCGGCTTCTGG + Exonic
1152357121 17:79812785-79812807 GGGAGCGGCGGGGTGGCCGCCGG + Intergenic
1152756053 17:82087546-82087568 GGGCTCTGGGAGGTGGCCCCAGG - Intronic
1153794414 18:8609532-8609554 GGGCGCAGAGAGCCGGCCGGCGG + Exonic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1155928932 18:31685559-31685581 GGGCGCGGGGAGGGGGCTGCTGG - Intronic
1156275731 18:35581530-35581552 GGGCGCCGCAGGGCGCCCGCAGG - Intronic
1160364131 18:78309582-78309604 TGGCGCTGCGAGGCTGACGCTGG + Intergenic
1160408635 18:78659920-78659942 GGAGGCTGCGAGGCTGCGGCTGG + Intergenic
1160426143 18:78780492-78780514 GGGAGCTGCGAGGAGGGCCCAGG - Intergenic
1160499969 18:79396591-79396613 GCGCGAGGCGAGGCCGCCGCGGG + Intronic
1160554837 18:79718283-79718305 GTGCTCTGCGGGGCGGCCACAGG - Intronic
1160778148 19:866168-866190 GGGTGCTGAGAGGCGGCCTGTGG - Intergenic
1160788701 19:913052-913074 GGGCGGGGCGCGGCGGGCGCCGG - Intronic
1160809013 19:1005018-1005040 GCGCCCTGCGGGACGGCCGCTGG + Exonic
1161222089 19:3122477-3122499 GGGCCCCGGGAGGCGGCCCCCGG - Exonic
1161312045 19:3600192-3600214 CGGCGCTGCGAGGCGACCGCCGG + Exonic
1161333745 19:3700184-3700206 GGTCGCTGCGGGGGCGCCGCCGG - Intronic
1162128235 19:8510865-8510887 GGGCGCGGCGGCCCGGCCGCGGG + Exonic
1162778685 19:12995718-12995740 GGGCGCAGCGCGGCGGAGGCCGG + Exonic
1163115189 19:15184944-15184966 GGCCGCTGCGAGTCTGCCCCTGG - Exonic
1163358321 19:16829476-16829498 GGGGGCTGAGCGGCGCCCGCTGG + Exonic
1163509432 19:17726315-17726337 GAGCGCTCCGAGGTGGCTGCTGG + Exonic
1164693794 19:30228682-30228704 GGGCGCGCCGAGGCCACCGCAGG - Intronic
1165129175 19:33621702-33621724 GGGCGCGGTCCGGCGGCCGCGGG - Intergenic
1165955426 19:39499257-39499279 GGGCGCTGCAGGGGGACCGCGGG - Exonic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1167441906 19:49513510-49513532 GGGCGGCGGGAGGCGGCCCCAGG + Intronic
1167463972 19:49640566-49640588 GGGCGCTCCGAGGAAGCAGCAGG + Intergenic
1168098352 19:54128179-54128201 GGAAGAAGCGAGGCGGCCGCAGG + Exonic
1168144910 19:54415517-54415539 GGGGGCAGCGGGGCGGACGCCGG - Exonic
1168239496 19:55082054-55082076 GGGCGCGGCGATGGGGACGCGGG - Intronic
925385735 2:3460390-3460412 GGGAGCCGCGAGGGAGCCGCTGG + Intronic
926154987 2:10448573-10448595 GGGCGGGGAGAGGCGGCCGCAGG - Intergenic
926155000 2:10448603-10448625 GGGCGGGGCGAGGCGGCCGCAGG - Intergenic
926320629 2:11746527-11746549 GGGCGGTGCGAGGGGGACTCGGG - Intronic
926422887 2:12716710-12716732 GGGAGCTGCGAGGCCGGTGCTGG + Intergenic
927156491 2:20224293-20224315 GGGCGCAGCGCGGCCGGCGCGGG - Intronic
927830499 2:26346050-26346072 GCGCACTGAGAGGCGGCCGAAGG + Intronic
927956606 2:27211795-27211817 GGGCGGAGCGAGCCGGCCTCCGG - Intronic
928089959 2:28367935-28367957 GGGCTGTGAGAGGCGGCGGCTGG + Intergenic
929581084 2:43082213-43082235 GGGCTCTGCGAGGCGGCCCAAGG + Intergenic
929756354 2:44768676-44768698 GGGCTCCGGGACGCGGCCGCCGG + Intronic
930177224 2:48314233-48314255 GGGCGGGGCTAGGCTGCCGCAGG - Intergenic
932314143 2:70768357-70768379 GGGCGCTGCGGGGCGGTAGTGGG - Intergenic
937206275 2:120238982-120239004 GGGCACTGTGAGGCTGCAGCGGG - Intergenic
938407020 2:131038413-131038435 GGGCGCTGCAAGGCTGCAGGAGG - Intronic
939612948 2:144332342-144332364 CGGCCCCGCGAGGCGGGCGCCGG + Intronic
941808673 2:169734330-169734352 GGGCGCCGCGTGCCGCCCGCGGG - Intronic
941911715 2:170770872-170770894 GGGCGCGGCGAGGAGGGCCCGGG - Intergenic
942046665 2:172102847-172102869 GGGCTCTGGGAGGCGGGAGCAGG + Exonic
942463845 2:176188502-176188524 GGGCGCTGGGCGGCGGCCCTGGG + Intergenic
943669985 2:190649500-190649522 GGGCTCCGCGCGGCCGCCGCCGG + Intronic
945102539 2:206275062-206275084 AGGACCTGCGAGGCGGCCGCGGG - Intronic
945119582 2:206443796-206443818 GCTAGCTGCGGGGCGGCCGCGGG - Exonic
946191599 2:218010540-218010562 GCGCGCTGCGGGGCGGATGCCGG + Intergenic
946843201 2:223837646-223837668 GGGCGCGGGGAGGAGGCAGCGGG - Intronic
948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG + Exonic
948140835 2:235670688-235670710 GCGGGCTGCGTGGCGGTCGCGGG - Intronic
948479264 2:238239991-238240013 GGCTGCTGCTGGGCGGCCGCGGG - Exonic
948963214 2:241356257-241356279 GCGCGCTGCGCGGGGGCTGCCGG + Exonic
1169113349 20:3046804-3046826 GGGCACCGCGACGCGGGCGCTGG + Intronic
1169164178 20:3407910-3407932 GGGCTCTGCGCGGCGCCCCCCGG + Intergenic
1171013849 20:21522765-21522787 TGGGGCTGCGCGGTGGCCGCGGG - Intergenic
1172284626 20:33732103-33732125 GGGCGCTGCGAGGGCGCGGCGGG - Intronic
1172583473 20:36065865-36065887 CGGGGCTGGGAGGAGGCCGCAGG + Intergenic
1172587285 20:36093510-36093532 GGGCGGTGGGTGGCGGCGGCGGG + Intronic
1175873813 20:62220300-62220322 GGGCGCTGCGCGGGGCGCGCGGG - Intergenic
1175889274 20:62309282-62309304 GGGCGGTGTGAGGCAGCTGCAGG + Exonic
1176061602 20:63175140-63175162 GTGCGCACCGAGGCGGCCGCCGG + Intergenic
1176125396 20:63472676-63472698 GGGCGGGGCGAGGCGGCGGGCGG - Intergenic
1176168380 20:63686209-63686231 AGGCGCTGCGTGGAGGCAGCAGG - Intronic
1176194464 20:63830961-63830983 GGGCGTGGCGGGGCGGCCGGCGG + Intronic
1176733402 21:10521624-10521646 GGGCGCAGCGAGTCCGGCGCTGG - Exonic
1178708293 21:34891115-34891137 GGGGGCTGCGAGTCGGACTCGGG + Intronic
1179988194 21:44932578-44932600 GGGCCCGGCGGGGCGGCCTCGGG + Intergenic
1180871618 22:19150030-19150052 GGGCCCCCAGAGGCGGCCGCCGG - Exonic
1181165723 22:20981999-20982021 GGGAACTGCGAGCCGGCCGCGGG + Exonic
1181570937 22:23767578-23767600 GGGCGCGGCTGGGCGGCTGCGGG + Exonic
1183664519 22:39239660-39239682 GGGCGTGGCGAGGAGGCAGCTGG + Intronic
1183665075 22:39242403-39242425 CGGCGAGGCGAGGCGGCAGCTGG + Intronic
1183903239 22:41021813-41021835 GGGGGCTGGGCGGGGGCCGCAGG + Intergenic
1184276555 22:43412173-43412195 GGGCGGGGCGCGGCGGGCGCGGG + Intronic
1184333574 22:43840615-43840637 GGGTGCTGCCAGGCTGGCGCTGG + Intronic
1184786663 22:46675375-46675397 GGGGGCTGAGAGGCAGCCCCGGG + Intronic
1185085905 22:48740940-48740962 GGGCCCTGCGAGGAGGCAGATGG - Intronic
1185313909 22:50170651-50170673 GGGCCCGGCGAGGGGGGCGCGGG - Intergenic
1185344990 22:50307187-50307209 GGGCGCTCCGGGCCGGCCCCAGG - Intronic
1185386136 22:50532012-50532034 GTGCGCCGCGATGGGGCCGCGGG + Exonic
950018404 3:9769778-9769800 GGGCGCTGCGTGGGGGCGGTGGG - Intronic
950316330 3:12004702-12004724 GGGCCCGGCGAGGCGGTCGGGGG - Exonic
952867228 3:37862120-37862142 GGGCGCGGCGCGGGGGGCGCGGG - Intronic
954382564 3:50227422-50227444 GGGGGCCGCGAGGCGGGGGCTGG + Intronic
955770322 3:62378622-62378644 GGGCGCTGCAAAACAGCCGCCGG - Intergenic
956813620 3:72888348-72888370 TGGCGCTGCGGGGCGGACGCGGG - Exonic
957078680 3:75619828-75619850 GTGTGGGGCGAGGCGGCCGCGGG - Intergenic
957215798 3:77317831-77317853 GGGGGCTGCTAGGGGGCTGCTGG + Intronic
962259868 3:133895536-133895558 GGGCGAGGGGAGGCGGCCGGCGG + Exonic
962809001 3:138946178-138946200 GGGTGCGGCGTGGCGGGCGCCGG - Exonic
962919101 3:139935276-139935298 GGGCACGGCGAGGCGGCCCACGG + Exonic
964358509 3:155871143-155871165 GGGGCCAGCGACGCGGCCGCGGG - Intronic
968377210 4:53586-53608 GAGGGCTGAGAGGCGGCAGCGGG - Intronic
968486852 4:867054-867076 GGCCCCTGGGAGGCGGCCTCAGG + Exonic
968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG + Intergenic
968729417 4:2262594-2262616 GGGCGCTCCGGGGCGTGCGCCGG + Intergenic
969021761 4:4143796-4143818 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
969732107 4:8963619-8963641 GTGCGGGGCAAGGCGGCCGCGGG + Intergenic
969791702 4:9497704-9497726 GTGCGGGGCGAGGCGGCCGCGGG + Intergenic
972632812 4:40856920-40856942 GGGGACAGCGAGGCGGGCGCGGG - Intronic
975118535 4:70705059-70705081 GGGCGAGGCGGGGCCGCCGCCGG + Intronic
975148308 4:70993775-70993797 GAGGGCTGGGAGGCGGCCACGGG - Exonic
978503650 4:109434132-109434154 GGGCGCGGTGCGGAGGCCGCGGG + Intronic
980053793 4:128061528-128061550 GGGCGCTGCGCGGCCTCGGCGGG + Intronic
984206461 4:176792763-176792785 GGGCGCTGCGGCGGGGGCGCTGG + Intergenic
985445127 4:190017551-190017573 AGGCGCAGCGCGGCGGCCGGCGG + Intergenic
985483870 5:137923-137945 AGACGCTGCGAGGCGGCCTGAGG - Intergenic
985523734 5:391425-391447 GGGCAGGGCGAGGCGGGCGCAGG + Intronic
985523749 5:391474-391496 GGGCAGGGCGAGGCGGGCGCAGG + Intronic
987441875 5:17966911-17966933 CGGCTCTGCGAGGCTGCAGCTGG + Intergenic
989229825 5:39073934-39073956 GGGTCCGGCGAGGCGGCCCCGGG + Intronic
996442996 5:123512613-123512635 GGCCGCGCCGAGGCAGCCGCCGG - Intronic
997454048 5:134004686-134004708 GGGGGCTGCGACGCGGAGGCAGG + Intronic
997470648 5:134115184-134115206 CGGCGCGGCGCGGCGACCGCGGG - Intronic
998583485 5:143403750-143403772 AGGGGCCGCGCGGCGGCCGCGGG + Intronic
999248386 5:150167285-150167307 CGGCGCAGCGTGGCGGCCGGAGG + Exonic
999462697 5:151771067-151771089 GGGCGCTGCGAGGCGGCCGCGGG - Intronic
1002455484 5:179343902-179343924 GGGCGCCACGAGGCGGGCGTTGG + Exonic
1003049335 6:2765770-2765792 GCGCGGTGCGACCCGGCCGCGGG - Exonic
1003645580 6:7910808-7910830 GGGCGCTGCGAGGGGACCGGAGG - Exonic
1003942600 6:11044109-11044131 GGGCGCTGCGGGTTCGCCGCTGG - Intronic
1004627921 6:17393926-17393948 GGGCGCGGCGACCCGGGCGCGGG + Intronic
1006472698 6:34237444-34237466 GGGCGGCGCGAGCCGGCGGCGGG + Intronic
1006820083 6:36886069-36886091 GGGCGCGGCGAGGCTGTCACAGG - Intronic
1007781585 6:44257570-44257592 GGGCGCTGCGTGGTCGCGGCAGG - Intronic
1009320836 6:62286275-62286297 GGGCGCTGGCAGAAGGCCGCGGG + Intergenic
1012939616 6:105402986-105403008 GGCAGCTGCGGGGCGGCCGGCGG + Exonic
1013232414 6:108169797-108169819 GCGCGCGGCGCGGCGGCCACCGG - Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1017877645 6:158537217-158537239 GGGGGCGGCGAGGCGGGCGCGGG - Intronic
1017962614 6:159234289-159234311 CAGCGCTGCGAGGCGGCAGTCGG - Exonic
1019536309 7:1531288-1531310 GGGCGGTGCGGGGAGGGCGCGGG + Intronic
1020023603 7:4883521-4883543 GGGCGCTGCTCGGCCGCTGCCGG - Intronic
1020252974 7:6484079-6484101 CGGCGCAGCGCGGCGGCCCCGGG + Exonic
1020309179 7:6855826-6855848 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
1020418016 7:7968749-7968771 GGGCGCTGGGAGGCGGTGCCGGG + Intronic
1020727290 7:11831886-11831908 GGGCGCTGCGGGGCCGCGCCGGG - Exonic
1021950476 7:25769422-25769444 GGGCGCTGGGAGGCCGAGGCGGG - Intergenic
1024089059 7:45920805-45920827 AGGCGCTGCTGGACGGCCGCGGG - Exonic
1029169142 7:98618294-98618316 GGTTGCTGCGAGGCTGCCGCGGG + Intronic
1029496334 7:100897057-100897079 GGGCGCTGCGGGGCGCGCGGCGG - Intergenic
1029549980 7:101232511-101232533 GGGCGCTGCGGGGAGGGCCCGGG + Exonic
1033339230 7:140479112-140479134 GGGCGCGGGGAGGGGGCCGCGGG - Intronic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034306447 7:150048342-150048364 GGGCGCGGGGAGGAGGCCGGTGG - Intergenic
1034800399 7:154052300-154052322 GGGCGCGGGGAGGAGGCCGGTGG + Intronic
1034830614 7:154304893-154304915 GCGCCCTGCGTGGGGGCCGCAGG + Intronic
1037899077 8:22677022-22677044 GGGCGCTGCCAGATGGGCGCTGG - Intergenic
1043502944 8:80874263-80874285 CGGGGCGGCGCGGCGGCCGCGGG + Intronic
1045098850 8:98825729-98825751 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098862 8:98825749-98825771 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098874 8:98825769-98825791 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098886 8:98825789-98825811 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098898 8:98825809-98825831 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098910 8:98825829-98825851 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045098922 8:98825849-98825871 GGGCGGGGCGGGGCGGCCGGGGG - Intronic
1045571314 8:103371557-103371579 CCGCGCTCCGAGGCCGCCGCAGG - Exonic
1049194576 8:141308272-141308294 GAGCGCTGCGAGGCTGCGGCCGG + Intronic
1049683253 8:143929169-143929191 GAGCGCAGCGTGGGGGCCGCAGG + Exonic
1049820374 8:144629777-144629799 GGGCGCTGGGTGGTGGCCGGGGG + Intergenic
1049861625 8:144902450-144902472 GGGGGCTGCGTGGGGGCGGCGGG + Intergenic
1052970091 9:34372113-34372135 TGGCGCTGCGGCGCGGCCGGCGG + Exonic
1056769142 9:89464432-89464454 GGGCGCAGCCAGGCTGCCTCTGG + Intronic
1057208078 9:93184981-93185003 GGGCGCGGCGCGGGGCCCGCGGG + Exonic
1057208129 9:93185195-93185217 GGGGGCGGCGGGGCGTCCGCGGG - Exonic
1057313415 9:93955134-93955156 GGGCGCCGCGATGCAGCGGCCGG - Exonic
1057337431 9:94166607-94166629 GGGTGCCGCGTGGCCGCCGCGGG + Intergenic
1057494959 9:95553501-95553523 GGCCGCGGCGGGGCGGCGGCTGG - Intergenic
1057758329 9:97853975-97853997 GAGCGCGGCGAGACGGCAGCAGG + Exonic
1058005141 9:99906580-99906602 GGGCCCTGCGGGGCGGGGGCGGG + Intergenic
1058885469 9:109319411-109319433 GGGCGCTGGGAGTCGACCCCGGG - Intronic
1059102494 9:111483915-111483937 GGGCCCGGCGGGGGGGCCGCTGG - Intronic
1059314155 9:113410136-113410158 GGGAGCTGCGAGGAGACCGGGGG + Exonic
1059633932 9:116154327-116154349 CGGCGAGGCGCGGCGGCCGCGGG - Exonic
1060544747 9:124453341-124453363 GGGAGCAGCGGGGCGGGCGCTGG + Exonic
1061181710 9:129028331-129028353 GGGCGGGGCGCGGAGGCCGCGGG + Intergenic
1061262634 9:129488542-129488564 GGGCGTGGAGAGGCGGCCGCGGG - Intergenic
1061365859 9:130172276-130172298 GGGCGCTGAGTGGCGGCTCCGGG + Intergenic
1061559825 9:131394747-131394769 GGGCGCTGAGCGGCGTTCGCGGG + Intronic
1062395115 9:136349685-136349707 GGACGCTGAGAGGAGGCCCCGGG + Exonic
1062462113 9:136666357-136666379 GGGGGCTGCGGGGCTGCTGCCGG + Intronic
1062568518 9:137173830-137173852 GGGTGCTGGGCGGCGGCTGCAGG + Intergenic
1203768390 EBV:38328-38350 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768440 EBV:38453-38475 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768490 EBV:38578-38600 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768540 EBV:38703-38725 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768590 EBV:38828-38850 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768640 EBV:38953-38975 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768690 EBV:39078-39100 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768740 EBV:39203-39225 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768790 EBV:39328-39350 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768840 EBV:39453-39475 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768890 EBV:39578-39600 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203768940 EBV:39703-39725 GGGGGCAGCCGGGCGGCCGCCGG + Intergenic
1203572026 Un_KI270744v1:140660-140682 GAGGGCTGAGAGGCGGCAGCGGG + Intergenic
1186669855 X:11757919-11757941 GGGCGCAGCCTGGAGGCCGCGGG + Intergenic
1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG + Exonic
1192546509 X:72018764-72018786 GGGCGCTGCAGTGCGGCTGCGGG + Intergenic
1192903317 X:75522971-75522993 GGGGGCTGCGGTGCTGCCGCCGG - Exonic
1197981032 X:132218038-132218060 GGGCCTTCCGCGGCGGCCGCAGG + Exonic
1198533633 X:137567067-137567089 GGGCTCAGTGAGGCGGCCTCGGG + Exonic
1199772507 X:150983773-150983795 GGGCGCTGGGCGGCGGCAGCGGG + Intronic
1200081476 X:153578897-153578919 GGGGGCTGTGAGGAGGCCACAGG + Intronic
1200100900 X:153688702-153688724 CGGCACGGCCAGGCGGCCGCCGG - Exonic