ID: 999462802

View in Genome Browser
Species Human (GRCh38)
Location 5:151771556-151771578
Sequence AGGTGGGGCCCGTGTACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999462802_999462809 1 Left 999462802 5:151771556-151771578 CCCAAAGTACACGGGCCCCACCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 999462809 5:151771580-151771602 GTGGCGCAACCGCTCCTGCATGG 0: 1
1: 0
2: 1
3: 4
4: 54
999462802_999462813 21 Left 999462802 5:151771556-151771578 CCCAAAGTACACGGGCCCCACCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 999462813 5:151771600-151771622 TGGAAAACGGATCTCCGCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 38
999462802_999462810 8 Left 999462802 5:151771556-151771578 CCCAAAGTACACGGGCCCCACCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 999462810 5:151771587-151771609 AACCGCTCCTGCATGGAAAACGG 0: 1
1: 0
2: 0
3: 15
4: 146
999462802_999462815 23 Left 999462802 5:151771556-151771578 CCCAAAGTACACGGGCCCCACCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 999462815 5:151771602-151771624 GAAAACGGATCTCCGCCCAGGGG 0: 1
1: 0
2: 0
3: 3
4: 30
999462802_999462814 22 Left 999462802 5:151771556-151771578 CCCAAAGTACACGGGCCCCACCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 999462814 5:151771601-151771623 GGAAAACGGATCTCCGCCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999462802 Original CRISPR AGGTGGGGCCCGTGTACTTT GGG (reversed) Intronic
902700579 1:18169313-18169335 AAGTGGGGCCCCTGTGCTTGGGG + Intronic
906065944 1:42980196-42980218 AGGTGGGGCCCTTGTCCTGAAGG + Intergenic
913563843 1:120050729-120050751 AGGAAGGGCCAGTGTACTGTGGG - Intronic
913634282 1:120742834-120742856 AGGAAGGGCCAGTGTACTGTGGG + Intergenic
914284437 1:146210103-146210125 AGGAAGGGCCAGTGTACTGTGGG - Intronic
914545469 1:148660844-148660866 AGGAAGGGCCAGTGTACTGTGGG - Intronic
914621099 1:149409829-149409851 AGGAAGGGCCAGTGTACTGTGGG + Intergenic
919802020 1:201359819-201359841 AGGAGGGGCCCGTGTACCACAGG + Intronic
922483946 1:225958724-225958746 AACTGGGGCCAGTGTCCTTTAGG - Intergenic
1068671054 10:59724063-59724085 AGGTGGGGCCCCTATCCTTATGG - Intronic
1074772944 10:116745020-116745042 AGGTGGGGCCTGTGTGTGTTTGG - Intergenic
1074981681 10:118624956-118624978 AGTTGGGACACGTGGACTTTGGG + Intergenic
1076504853 10:130964912-130964934 AGGTGGAGCCCGGGTACTGGGGG + Intergenic
1078897634 11:15611527-15611549 AGGTGGGGTCTGTGTGCTCTGGG + Intergenic
1081411526 11:42764183-42764205 AGGTGGAGTCCCAGTACTTTGGG - Intergenic
1088973911 11:114797757-114797779 AGATGGTGTCCGTGAACTTTGGG + Intergenic
1096086348 12:48867674-48867696 TGATGGGGCCCCTGTATTTTGGG + Intergenic
1102819489 12:115895693-115895715 TGGTGGGGCCTGTGGGCTTTGGG + Intergenic
1113749556 13:112767886-112767908 AGGTGTGGCCCGTGGACTTGTGG + Intronic
1113890463 13:113732659-113732681 AGGTGGGTGCCGTGCATTTTGGG - Intronic
1117658720 14:57982846-57982868 GGGTGAGGCCCATGTAATTTTGG - Intergenic
1123074528 14:105661395-105661417 AGGTGGGGCCTGGGTGCTTCAGG + Intergenic
1125432081 15:39605615-39605637 AGGTGGGGGCTGTGTCCTCTTGG + Intronic
1127294541 15:57597914-57597936 AGGTGGGGCCCTTGTAAGTGTGG - Intronic
1129462043 15:75704445-75704467 ATCTGGGGCCCGTGTGCTTCTGG - Intronic
1130358270 15:83155301-83155323 AGGTGGAGCCCCATTACTTTTGG + Intronic
1132606891 16:797321-797343 GGGTGGGGCCAGGGTACCTTTGG + Intronic
1141705776 16:85663679-85663701 AGGTGGGGCCGGTGGACTCCAGG + Intronic
1141799302 16:86296217-86296239 AGGTGGGGCTGGTGTGCTGTTGG + Intergenic
1143122402 17:4616971-4616993 AGGTGGTGACACTGTACTTTGGG - Intergenic
1152558896 17:81068078-81068100 ACGTGGGTCCCATGCACTTTGGG + Intronic
1161684976 19:5698104-5698126 AGGTGGGGCCAGTGCAGCTTTGG - Intronic
1164853637 19:31504072-31504094 AGGTGGGGCATTTGGACTTTAGG - Intergenic
928347195 2:30511148-30511170 AGGTGAGGCTTGTGAACTTTGGG + Intronic
931234217 2:60399754-60399776 ATGTGGGCCTCGTGCACTTTAGG + Intergenic
940626488 2:156181751-156181773 AGGTGGGGCCTGAGTTATTTGGG - Intergenic
941129088 2:161624641-161624663 AGGTGCAGCGAGTGTACTTTTGG + Intronic
946808645 2:223498441-223498463 AAGTGGGGCACGAGTACTTGTGG - Intergenic
1171451383 20:25238352-25238374 AGCTGGAGCCCCTGTCCTTTGGG - Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1176138040 20:63533612-63533634 AGCTGGGGTCCGGCTACTTTGGG - Exonic
1181162320 22:20966060-20966082 GGGTGGGGCCCCTGTGCCTTCGG - Intronic
1183667883 22:39255720-39255742 AGGAGGGGCCCGTGCACTGGAGG + Intergenic
956747649 3:72322372-72322394 AGGTGGGGCCTGTCTTCTTGGGG - Intergenic
960307405 3:116078740-116078762 AGCTGGCTTCCGTGTACTTTTGG + Intronic
960402973 3:117226530-117226552 AGGAAGAGCCCGTGTACTTTAGG + Intergenic
961030663 3:123600742-123600764 AGCTGGGGCCTGTTTACTGTGGG + Intergenic
968495836 4:914819-914841 TGTTGGGGGCCGTGTACGTTGGG - Intronic
971912720 4:32815191-32815213 AGGTGGTTCCCTTATACTTTTGG - Intergenic
995527884 5:113065058-113065080 AGGTGGAGCCAGAGAACTTTTGG + Intronic
998205710 5:140155542-140155564 AGGAGGAGCCTGTGTACTTAGGG + Intergenic
999166063 5:149550749-149550771 AGGAGAGGCCCGAGCACTTTGGG + Intronic
999462802 5:151771556-151771578 AGGTGGGGCCCGTGTACTTTGGG - Intronic
1000297831 5:159927513-159927535 AGCTGGGGCACCTGTATTTTTGG - Intronic
1006435307 6:34023018-34023040 AGGCGGGGCCGGTGCAGTTTGGG - Intronic
1007679849 6:43626457-43626479 AGGTGGGGACCATGTAGGTTTGG - Intronic
1012623056 6:101372288-101372310 AGGTGGAGCCCTTGCCCTTTAGG - Intergenic
1024330165 7:48147386-48147408 AGGTGGAGCCCGAGAACTCTGGG - Intergenic
1024632245 7:51259477-51259499 AGGTGGGGCCCATCTCCTTGAGG + Intronic
1033428346 7:141265653-141265675 AGGTGGGGCACGTCTCTTTTGGG + Intronic
1035459941 7:159032382-159032404 AGGCGGGGCCTGTGTAGGTTTGG - Intronic
1049733687 8:144192185-144192207 AGGTGGGGCCCATGTCCTCCTGG + Intronic
1051482366 9:17574638-17574660 GGGAGAGGCCCCTGTACTTTGGG + Intergenic
1055358675 9:75465202-75465224 AGGTGGGACATGTGAACTTTTGG + Intergenic
1059390931 9:113999198-113999220 AGGTGGGGGCCCTGGGCTTTAGG + Intronic
1060796519 9:126515805-126515827 AGGTGAGGGCCGTGTACTCAGGG + Intergenic
1061927735 9:133814288-133814310 AGGTGGGGGCTGTGTCCTTGGGG - Intronic
1192433903 X:71130488-71130510 AGGTGTGGGCCGTGTATATTTGG + Intronic
1199217880 X:145282058-145282080 AGGTGAGGCTCCTCTACTTTTGG - Intergenic
1200375669 X:155777298-155777320 AGGAGGGGCTCGTGTTATTTTGG - Exonic