ID: 999462910

View in Genome Browser
Species Human (GRCh38)
Location 5:151772166-151772188
Sequence CCGCGCGCGCCTGCGGCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999462910_999462922 29 Left 999462910 5:151772166-151772188 CCAACGGCCGCAGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 999462922 5:151772218-151772240 CTCCCGCTCCCGTCCCGGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 193
999462910_999462923 30 Left 999462910 5:151772166-151772188 CCAACGGCCGCAGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 999462923 5:151772219-151772241 TCCCGCTCCCGTCCCGGCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 189
999462910_999462917 -4 Left 999462910 5:151772166-151772188 CCAACGGCCGCAGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 999462917 5:151772185-151772207 GCGGCGGACGGACGGGCGCGCGG 0: 1
1: 1
2: 2
3: 36
4: 390
999462910_999462920 24 Left 999462910 5:151772166-151772188 CCAACGGCCGCAGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 999462920 5:151772213-151772235 CCTCGCTCCCGCTCCCGTCCCGG 0: 1
1: 0
2: 0
3: 21
4: 224
999462910_999462918 -1 Left 999462910 5:151772166-151772188 CCAACGGCCGCAGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 999462918 5:151772188-151772210 GCGGACGGACGGGCGCGCGGCGG 0: 1
1: 0
2: 5
3: 41
4: 283
999462910_999462921 28 Left 999462910 5:151772166-151772188 CCAACGGCCGCAGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 999462921 5:151772217-151772239 GCTCCCGCTCCCGTCCCGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999462910 Original CRISPR CCGCGCGCGCCTGCGGCCGT TGG (reversed) Intronic
900206916 1:1435583-1435605 CCGCTCGCGCCGGAGGGCGTGGG + Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
901850016 1:12009065-12009087 CGGCGCGCGCCTGCAGTCGCAGG + Intronic
903652317 1:24929741-24929763 CTGAGCGCGCAGGCGGCCGTGGG - Exonic
903748310 1:25603390-25603412 CGGCGCGCACCTGCAGTCGTAGG - Intergenic
906627141 1:47334262-47334284 CGCCGCGCGCCGGCGGCCCTCGG - Intronic
907216788 1:52870726-52870748 CGGCGCGCGCCTGCAGTCGCAGG + Intronic
912360430 1:109090584-109090606 CTGCGTGCCCCTGCGGGCGTAGG - Exonic
914489984 1:148146085-148146107 CCGCCCGCCCGTGCGTCCGTCGG - Intronic
920665479 1:207959753-207959775 CCTCGCGCGACTGCAGCCCTGGG - Intergenic
922753535 1:228082155-228082177 CCGCGCGTCACTGCGGCCGCCGG + Intergenic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
1063115440 10:3068599-3068621 CCCGGCGCGCCCGCGTCCGTGGG - Intronic
1068134835 10:52941151-52941173 CCGTGCATGCCTGCGGCTGTTGG - Intergenic
1071997566 10:91163004-91163026 GCGCGCGCGCGTGGGGCGGTAGG - Intronic
1076157027 10:128212089-128212111 GGGCGCGCGTCTGCGGCCGCGGG + Intergenic
1076306223 10:129467254-129467276 CCGCGAGGACCTGCGGGCGTCGG - Exonic
1076792729 10:132785644-132785666 CCGCGCGCCACAGCGGCCGCGGG + Exonic
1077103074 11:830689-830711 ACGCGCGGGCCTGCGGCAGCGGG + Exonic
1077675044 11:4187763-4187785 CCGCGCTCGACTGCTGCTGTCGG - Intergenic
1078317035 11:10302920-10302942 CCGCGCGCGCCTCCGACTGCTGG - Intergenic
1081528279 11:43942078-43942100 GCGCGCGCGCCTGCGGAGGGGGG + Intronic
1084028485 11:66467159-66467181 CCGCGCGTCCCTGCGGTCGCGGG + Intronic
1086697987 11:89865599-89865621 CCGCCCACGCCTCCGGCCGCCGG - Intergenic
1086708175 11:89978889-89978911 CCGCCCACGCCTCCGGCCGCCGG + Intergenic
1089966161 11:122656247-122656269 CCGCGCGCGCGGCCGGCCCTCGG + Intronic
1092365394 12:7872882-7872904 CCGGCCCCGCCTGCAGCCGTTGG + Intronic
1096389585 12:51218086-51218108 CCGCCCGCGCCAGCCGCCGGGGG + Intergenic
1113768371 13:112894419-112894441 CCGCGCGCACCTGCCGCCCGTGG - Intronic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1118925693 14:70188496-70188518 CCGGACGCGGCTGCGGCCGGCGG - Exonic
1122275033 14:100586946-100586968 ACGCGCGCCCCTGCGGCGGAAGG - Intronic
1126348358 15:47718829-47718851 CCGCTCGCGCCGGCAGCCGCTGG + Exonic
1128528912 15:68431209-68431231 CCGCGCGCCCCTCGGGCCGGAGG + Intronic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1129438107 15:75558659-75558681 CGGCGCGCGCCTGCAGTCGCAGG - Intronic
1130002613 15:80060055-80060077 GCGCGGGCGCCCGCGGCCGGGGG + Intronic
1131277448 15:90994172-90994194 CTGCGGGCACCTGCGGCCGCCGG + Intronic
1132398160 15:101489316-101489338 TCGCGCGCGCCGGAGGCCGCCGG + Intronic
1132841522 16:1980482-1980504 CCTGGCGCGCCTGCAGCTGTTGG - Exonic
1133021465 16:2968796-2968818 CCTCACGCGCCCGCAGCCGTCGG - Intronic
1138178718 16:54928827-54928849 CCGCGCGCGCCGCCCGCCGGGGG - Intergenic
1139465042 16:67149989-67150011 CCGCCCGAGCCTGCGCCCCTGGG + Exonic
1144730420 17:17522809-17522831 CCGCGTGCTCCTGCAGCCATGGG - Intronic
1145190590 17:20840736-20840758 CCGCCCGCCCGTGCGTCCGTCGG - Intronic
1147974028 17:44237547-44237569 CGGCGCGCGCCTGCGATCGCAGG - Intergenic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1151210465 17:72540474-72540496 CCGCCCGCGCCCGCGCCCGGTGG + Intergenic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG + Intronic
1153794448 18:8609629-8609651 CCGCGCGCGGCGGAGGCCGAGGG + Exonic
1157794109 18:50559633-50559655 CCCCGCGCGGCTGCAGCCGCCGG - Intergenic
1160592140 18:79951001-79951023 CCGCGCGCTCCTGCGGCCTCGGG + Exonic
1160719546 19:591119-591141 CGGTGCGCGCATGCGGCGGTGGG + Intronic
1160892002 19:1383973-1383995 CCGCGCGGGTCTGGGGCCGTGGG + Intronic
1160930742 19:1568418-1568440 CCCCGCGCGCCTGCGCCCTGGGG - Intergenic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1160996725 19:1885402-1885424 CCGCCCGCCCGTGCGTCCGTCGG + Exonic
1161203592 19:3029071-3029093 GCGCGCGCGCCCGGGGTCGTGGG + Exonic
1164834762 19:31349910-31349932 CCACGCGGGCCTGGGGCCGGGGG - Intergenic
1164995682 19:32719544-32719566 CCGCGTGCGGCTGAGTCCGTTGG - Intergenic
1165349802 19:35269336-35269358 CCGGCCGCGCCTGAGGCCGGGGG - Intronic
1166189944 19:41169867-41169889 CTGCGCGACCCTGTGGCCGTGGG + Intergenic
1166706105 19:44908881-44908903 CCGCGAGCGCCTGGGGCCCCTGG + Exonic
928834141 2:35522817-35522839 CCGCATGTGCCTGCGGCTGTTGG + Intergenic
929218038 2:39436856-39436878 CCGCGCGCCGCCGAGGCCGTGGG - Intronic
934479506 2:94622291-94622313 CCGCCCGCGCCTTCCCCCGTGGG - Intergenic
935815524 2:106843185-106843207 CCGCGCGCGCGTGCGGACGCTGG - Exonic
936713609 2:115161419-115161441 CCGCGGAAGCCGGCGGCCGTGGG + Intronic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
942459105 2:176157416-176157438 CCGCGCCCGCCGGGGGCCGGGGG - Intronic
948369014 2:237475556-237475578 GCGCGCCCGGCTGCAGCCGTCGG + Intergenic
1169220655 20:3820519-3820541 CCGTGGGCGCCTGCGCACGTCGG - Intronic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1174258802 20:49278276-49278298 CCGCGCCCGCCTGAGCCCGCCGG - Intronic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1179784054 21:43719692-43719714 CCGCCCGCCCCCGCGGCAGTTGG - Intronic
1180110260 21:45644026-45644048 CCGCAGGCGCCGGCGGCGGTCGG - Intronic
1180177606 21:46098128-46098150 GCGCCCGCGCCTCGGGCCGTCGG + Exonic
1184767074 22:46577504-46577526 CCGCGGGCACCTGCGGCCGCAGG + Intronic
1185403071 22:50628268-50628290 CCGTGTGCGCCTGAGGCTGTTGG + Intergenic
949987811 3:9553640-9553662 GCGCGCGAGGCTGCGGCCGCGGG + Intronic
950366024 3:12484722-12484744 CCTCGTGCGCCTGCAGCCCTTGG + Exonic
950759364 3:15206644-15206666 CGGCCCGGGCCTGCGGCCGAGGG + Intronic
953183231 3:40615701-40615723 CCCCGCGCGCCTGCTGCAGGGGG + Intergenic
953319015 3:41955451-41955473 CTGCGCGACCCTGTGGCCGTGGG + Intronic
953922677 3:46963586-46963608 CGGCGCGCGCCTGCGATCGCAGG - Intronic
954400995 3:50319578-50319600 CCCCGTGAGCCTGCGGCTGTAGG + Exonic
954735814 3:52705847-52705869 GCGGGGGCGCCGGCGGCCGTTGG + Exonic
961305970 3:125959285-125959307 CTGCCGGCCCCTGCGGCCGTGGG + Intergenic
963827294 3:149970215-149970237 CCTCCCGCGCCTCCGGCTGTGGG - Intronic
969240357 4:5893073-5893095 CCGGGCGCGACTGCGGCCCAGGG + Intergenic
974069462 4:57110515-57110537 GCGCGCGCTCCTGCTGGCGTCGG + Intergenic
982370338 4:154626926-154626948 CCGAGCGCTCCTGCGGCGGCTGG - Intronic
983218288 4:165020813-165020835 CGGCGCGCGCCTGCAGTCGCAGG + Intergenic
991063636 5:62403728-62403750 CCGCCCGCGGCGGCGGCCGATGG + Exonic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
995161992 5:108993404-108993426 CCGCGCGCGCCTGCAATCGCAGG + Intronic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1002190146 5:177473638-177473660 CCGAGCGAGCCAGCGGCCGGGGG + Intronic
1003072108 6:2952960-2952982 CCTCCCGCGTCTGCAGCCGTGGG - Intronic
1013530928 6:111018078-111018100 CGGCGCGCGCCTGCAGTCGCAGG + Intronic
1014233979 6:118935031-118935053 CCGCGCGTCCCCGCGGCCGGTGG - Exonic
1015654158 6:135497907-135497929 TCGCGCCCGCCTGCGGCCTGAGG - Intergenic
1019473381 7:1232931-1232953 CCGCCCGCGCCTCCCGCCGCTGG + Exonic
1021647238 7:22800377-22800399 CAGCGCGCGCCTGCAATCGTAGG - Intergenic
1022018501 7:26376430-26376452 CCGCGCGGGCCTGCGGCTCCCGG + Intergenic
1022427827 7:30285141-30285163 CCGCGCCCGCGTCAGGCCGTCGG + Exonic
1025078868 7:55965036-55965058 CAGCGCGCGCCTGAGGCCGCAGG + Intronic
1031966550 7:128031651-128031673 CCGCGCGCTCCTCCGGCCGGCGG - Intronic
1036803240 8:11808515-11808537 CCGCAGGCGGCTGCGGCCATGGG - Intronic
1038540376 8:28385917-28385939 CCCCGCGCGCCCGCGGCTGTCGG - Intronic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1043388226 8:79768224-79768246 CCGCACGCGCCGCGGGCCGTGGG + Intergenic
1043388314 8:79768523-79768545 CAGCGCGCGCCTCCAGCCGCCGG - Intergenic
1044719756 8:95134007-95134029 CCGCCGCCGCCCGCGGCCGTCGG + Exonic
1044999771 8:97869275-97869297 CCGCGCTCACCTGCAGCCGCCGG - Exonic
1049645193 8:143733033-143733055 CCGCGCCCTCCTGCGCCCATCGG - Intronic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1053678324 9:40461290-40461312 CCGCCCGCGCCTTCCCCCGTGGG + Intergenic
1054285403 9:63163658-63163680 CCGCCCGCGCCTTCCCCCGTGGG - Intergenic
1054291401 9:63296827-63296849 CCGCCCGCGCCTTCCCCCGTGGG + Intergenic
1054389417 9:64601365-64601387 CCGCCCGCGCCTTCCCCCGTGGG + Intergenic
1054506296 9:65915005-65915027 CCGCCCGCGCCTTCCCCCGTGGG - Intergenic
1057997138 9:99828685-99828707 CTGAGCGCGGCAGCGGCCGTCGG - Exonic
1058018702 9:100067321-100067343 CGGCGCGCGCCTGCAGTCGCAGG - Intronic
1060477952 9:123999691-123999713 CTGCGGGCGCGTGCGGCCGGGGG - Intergenic
1060979622 9:127785127-127785149 CCGCGCCCCCTGGCGGCCGTCGG + Intergenic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062596546 9:137302337-137302359 ACGCGCGCGCCGGCGGCCCCGGG + Intergenic
1062651362 9:137579355-137579377 CAGAGCGCGCCTGCGGCCTCGGG - Intergenic
1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG + Intergenic
1189617030 X:42794448-42794470 CCGCACGCACCTGCAACCGTTGG + Intergenic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG + Intergenic
1195009668 X:100723250-100723272 CGGCGCGCGCCTGCGATCGCAGG - Intronic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic