ID: 999464950

View in Genome Browser
Species Human (GRCh38)
Location 5:151794043-151794065
Sequence ATGAGACATCTGGCAATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1084
Summary {0: 1, 1: 2, 2: 39, 3: 220, 4: 822}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999464950_999464954 6 Left 999464950 5:151794043-151794065 CCAGATATTGCCAGATGTCTCAT 0: 1
1: 2
2: 39
3: 220
4: 822
Right 999464954 5:151794072-151794094 AGACTTGTCCCAGTCACCAATGG 0: 1
1: 0
2: 2
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999464950 Original CRISPR ATGAGACATCTGGCAATATC TGG (reversed) Intronic
900691410 1:3982667-3982689 AGGAGACATTTGGCAATGTTTGG + Intergenic
900794836 1:4701673-4701695 AGGGGACATTTGGCAATATCTGG - Intronic
901151757 1:7108001-7108023 ATGGGACATTTGACAATGTCTGG + Intronic
901607185 1:10468336-10468358 AGGAGACATCTGACAATATCTGG + Intronic
902110793 1:14076616-14076638 AGAGGACATCTGGCCATATCTGG - Intergenic
902123428 1:14187597-14187619 AGGTGACATCTGGCAATGTCTGG + Intergenic
902207286 1:14878401-14878423 TTGAGACATATGGCAATGTCTGG - Intronic
902208317 1:14886064-14886086 ATAAGGCATTTGGGAATATCTGG - Intronic
902234645 1:15049511-15049533 AGGGGACATCTGGCCATGTCTGG - Intronic
902365101 1:15967964-15967986 AGGAGATATTTGGCAATATCTGG + Intronic
902532066 1:17097000-17097022 AAGGGACATTTGACAATATCTGG - Intronic
902790431 1:18764207-18764229 AGGAGACATTTGGCAATGTCTGG + Intergenic
902888207 1:19422183-19422205 AGGAGACATCTGGCAATGTATGG + Intronic
903397437 1:23012624-23012646 AGGGGACATTTGGCAATATCTGG + Intronic
903492024 1:23736451-23736473 CAGAGACATCTGCCAATATTGGG + Intergenic
903516636 1:23915656-23915678 AGGGGACACTTGGCAATATCTGG + Intergenic
903718386 1:25386281-25386303 AGGGGACATCTGACAATGTCTGG - Intronic
904246711 1:29193369-29193391 AGGAGACATTTGACAATGTCTGG - Intronic
904899359 1:33844232-33844254 TAGGGACATCTGGCAATGTCTGG + Intronic
904933002 1:34105348-34105370 AGGGGACATTTGGCAATATCTGG - Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905158234 1:36007119-36007141 AGGGGACATTTGGCAATGTCTGG - Intronic
905187109 1:36204487-36204509 AGGAAACATCCGGCAATATCTGG - Intergenic
905627884 1:39500328-39500350 AGGAAACATTTGGCAATATCTGG + Intronic
905653199 1:39670019-39670041 ATGAGATATATGGTAATATCTGG - Intronic
905928096 1:41766235-41766257 AGGGGATATCTGGCAATGTCTGG + Intronic
906021622 1:42634300-42634322 AAGGGACATTTGGCAATGTCTGG + Intronic
906370791 1:45251843-45251865 AGGGCACATTTGGCAATATCTGG + Intronic
907033149 1:51192308-51192330 AAGAGACATTTGGCAATTTCTGG + Intergenic
907502844 1:54895334-54895356 AGGGGACATGTGGCAATGTCTGG - Intergenic
907510594 1:54955397-54955419 AGGGGACATTTGGCAATTTCTGG + Intergenic
907573286 1:55503677-55503699 CTGGGACATTTGGCAACATCTGG + Intergenic
907984773 1:59519934-59519956 AGGGGACATTTGGCAATGTCTGG + Intronic
908151983 1:61311628-61311650 AGGTGACATTTGGCAATGTCTGG - Intronic
908977561 1:69917533-69917555 AGGAGACATTTGACAATGTCTGG + Intronic
909196717 1:72635959-72635981 CAGAGACATTTGGCAATGTCTGG - Intergenic
909425859 1:75523749-75523771 AGGGGACATTTGACAATATCTGG + Intronic
909765725 1:79353706-79353728 ATGATCCAGCTAGCAATATCTGG + Intergenic
909773002 1:79448662-79448684 GGGAGACATTTGGCAATGTCTGG - Intergenic
909849438 1:80441838-80441860 AGGAAACATTTGGCAATGTCTGG - Intergenic
910181584 1:84490082-84490104 AGGACACATTTGGCAATGTCTGG - Intronic
910345367 1:86230231-86230253 AAGAGACACATGGCAAAATCTGG + Intergenic
910534775 1:88284596-88284618 ATGAAAAATTTGGCAATGTCTGG + Intergenic
910898037 1:92089317-92089339 AGAGGACATCTGGCAATGTCTGG - Intronic
911208021 1:95112177-95112199 AGGAGACACGTGGCAATGTCTGG - Intergenic
911226699 1:95315030-95315052 ATGAGACCTGTGGAAAGATCAGG - Intergenic
911694185 1:100869915-100869937 AGGGGACATCTGGCAATGTCTGG - Intergenic
912198056 1:107423287-107423309 AGGGGACATTTGGCAATGTCTGG + Intronic
913015509 1:114729937-114729959 AGGGGACATTTGGCAATGTCTGG + Intronic
913134370 1:115873761-115873783 ATGAAACATGTGGCAATGTCTGG + Intergenic
914574085 1:148948906-148948928 ATTAGACTTCAGACAATATCAGG + Intronic
915126186 1:153666700-153666722 AGGGGATATCTGGCAGTATCTGG - Intronic
915320365 1:155052823-155052845 TTGAGACACCTGGCTATACCGGG - Intronic
916011020 1:160705896-160705918 AAGGGACATTTGGCAATATCTGG - Intronic
916062721 1:161111544-161111566 AGGAGACATCTGGCAGTGTCTGG - Intronic
916416429 1:164596473-164596495 AGGGGCCATTTGGCAATATCTGG + Intronic
916428533 1:164705200-164705222 AGGAGACATCTGGCAATGTCTGG - Intronic
916526809 1:165618101-165618123 AGGGGACATTTGGCAATGTCTGG - Intergenic
916627631 1:166575526-166575548 ATCAGGAATCTGGCAATATAAGG + Intergenic
916854385 1:168735185-168735207 AGGAGACATTTAGCAATGTCTGG - Intergenic
917071329 1:171154430-171154452 AGGTGACATATGGCAAAATCTGG + Intronic
918028491 1:180778649-180778671 AAGGGACATTTGGCAATATCTGG - Intronic
918190736 1:182171701-182171723 AGGGGACATTTGGCAATGTCAGG - Intergenic
918333128 1:183479405-183479427 AGGGGACATCTGGCAATGTGTGG - Intronic
918475300 1:184918041-184918063 AGGAGACATTTGGAAATATGCGG - Intronic
918517209 1:185376155-185376177 AGGAGACATTTGGCAGTGTCTGG - Intergenic
919712829 1:200745294-200745316 AGGAGACATCTGGAGATGTCTGG - Intronic
919807740 1:201390768-201390790 AGGAGACATTTGGCAATGTCAGG - Intronic
920877184 1:209847732-209847754 CAGGGACATTTGGCAATATCTGG + Intronic
921071537 1:211662543-211662565 AAGAGACGTTTGGCAATGTCTGG - Intronic
921167402 1:212516929-212516951 AGGGGACATTTGGCAATGTCTGG + Intergenic
921256284 1:213342734-213342756 ATGAGACACCAGACAATCTCTGG + Intergenic
921577101 1:216848103-216848125 ACGGGACATTTGCCAATATCTGG - Intronic
921618821 1:217303972-217303994 ATAAAACATCTAGCAATTTCTGG - Intergenic
922234192 1:223711157-223711179 AGGAGACATTTGGGAATGTCTGG - Intronic
922531256 1:226347055-226347077 AGGGGACATTTGGCAACATCTGG + Intergenic
923054806 1:230417969-230417991 AGGGGACATTTGGCAATGTCTGG + Intronic
923223741 1:231920126-231920148 AAGGGACATCTGGCAAGGTCTGG - Intronic
924055408 1:240119485-240119507 AGGAGACACTTGGCAATGTCTGG + Intronic
924186391 1:241495713-241495735 AGGGGACATTTGGCAATGTCTGG - Intergenic
924352912 1:243136142-243136164 ATAAGACAGCTGGAAAGATCAGG - Exonic
1063587634 10:7366918-7366940 AGGGGACACCTGGCAATATCTGG - Intronic
1063686466 10:8241555-8241577 AGGGGACATTTGGTAATATCCGG - Intergenic
1064729304 10:18313419-18313441 AGGAGACATCTGGCAGGTTCTGG - Intronic
1065468318 10:26049402-26049424 ATGAGAAATAGGGCAATAGCTGG + Intronic
1065535545 10:26711781-26711803 ATGGGACACTTGGCAGTATCTGG - Intronic
1065789028 10:29242910-29242932 ATGGGACATTTGGCAACACCTGG + Intergenic
1065990430 10:31004081-31004103 AGGAGACATCTGGCAATATCTGG + Intronic
1066073424 10:31846328-31846350 ATAAGAAAACTTGCAATATCAGG - Intronic
1066473296 10:35720133-35720155 AGGAGACATTTGGCAATGTCTGG - Intergenic
1067420390 10:46140344-46140366 ATGAGACATCAATCAATATATGG + Intergenic
1067425631 10:46209175-46209197 ATGAGACATCAATCAATATATGG - Intergenic
1067505734 10:46846827-46846849 ATGAGACATCAATCAATATATGG + Intergenic
1067938598 10:50633022-50633044 AGGGGACATTTGGCAATGTCTGG - Intergenic
1068066440 10:52138247-52138269 AAGTGACATCTGGCAAAAACCGG + Intronic
1068430575 10:56926728-56926750 AAGAGACATTTGGTAATATCTGG - Intergenic
1068768484 10:60793008-60793030 AGGAGACATTTGGCAATATCTGG - Intronic
1068834484 10:61538838-61538860 CAGAGACATCTGGCAAAATCTGG + Intergenic
1069020906 10:63487371-63487393 TTGGGACATTTGGCAATGTCTGG + Intergenic
1069073382 10:64013219-64013241 AGGGGACATTTGGCAATATTTGG - Intergenic
1069882991 10:71605353-71605375 AGGAGACATTTGGCAATGTCTGG + Intronic
1070666621 10:78349566-78349588 AGGGGACATTTGGCAATGTCTGG + Intergenic
1071611241 10:87033187-87033209 ATGAGACATCAATCAATATATGG + Intergenic
1071726091 10:88199475-88199497 AGGAGACATTTGGCAATATCGGG - Intergenic
1072065761 10:91869803-91869825 AGGGGACATTTGGCAATGTCTGG - Intergenic
1072436287 10:95417216-95417238 AAGAGTCATCTGGCAATCTGCGG + Intronic
1072490457 10:95900432-95900454 AGGAGACATTTGACAATGTCTGG - Intronic
1073302230 10:102477898-102477920 AGGACACATCTGGCAATGCCTGG - Intergenic
1073504932 10:103977016-103977038 AGGAGACATTTGGCAATGTCTGG - Intronic
1074119328 10:110481755-110481777 AGGGGACATCTGGCCATGTCTGG - Intergenic
1074212577 10:111350664-111350686 AGGGGACATTTGGCAATGTCTGG + Intergenic
1074283525 10:112076359-112076381 GAGAGACATTTGCCAATATCTGG + Intergenic
1074404516 10:113169482-113169504 AGGGGACATCTGGCGATGTCTGG - Intergenic
1074659951 10:115642919-115642941 AGGAAACATTTGGCAATGTCTGG + Intronic
1074694638 10:116038522-116038544 AGGGGACATTTGGCAATGTCTGG - Intergenic
1074900262 10:117810472-117810494 CTGGGACACTTGGCAATATCTGG - Intergenic
1074958694 10:118418880-118418902 ATGGGATATTTGGCAATGTCTGG - Intergenic
1075051772 10:119187576-119187598 AGGGGACATTTGGCAACATCTGG - Intergenic
1075124462 10:119688575-119688597 AGGGGACATTTGGCAATGTCTGG - Intergenic
1075149706 10:119916214-119916236 AGGGGACATCTGGCAATTTCTGG - Intronic
1075306209 10:121369964-121369986 AGGAGTCATTTGGCAATGTCTGG + Intergenic
1075924879 10:126243242-126243264 ATAAGACATCTGGCAAGGGCTGG - Intronic
1075956808 10:126531270-126531292 AGGGGACATTTGGCAATGTCTGG + Intronic
1076618741 10:131773464-131773486 AGGGGACATCTGGCAGTGTCTGG + Intergenic
1077458350 11:2694337-2694359 AGGGGACATATGGCAATGTCTGG + Intronic
1077467274 11:2739329-2739351 ATGTGACCTCAGGCAATCTCGGG - Intronic
1077749080 11:4943647-4943669 AAGAGACATTTGGCAATGTCTGG - Intronic
1077990439 11:7405343-7405365 ACGAGACATTTGACACTATCTGG - Intronic
1078624366 11:12940372-12940394 ATGGGATATTTGACAATATCTGG - Intronic
1079410326 11:20181424-20181446 ACGGGACATTTGGCAATGTCTGG + Intergenic
1080017041 11:27518558-27518580 ATAGGACATTTGGCAATATTTGG + Intergenic
1080210456 11:29779846-29779868 AGGGGACATTTGGCAATGTCTGG - Intergenic
1080784752 11:35464568-35464590 AGGGGACATTTGGCAATGTCTGG - Intronic
1080926238 11:36759492-36759514 TTGGCACATCTGGCAATGTCTGG + Intergenic
1081102931 11:39027634-39027656 ATAAGACATCTGGCAATACCTGG + Intergenic
1081536004 11:43996711-43996733 AAGAGACTTCTGGAAACATCTGG - Intergenic
1081815916 11:45941433-45941455 ATCACACATCATGCAATATCTGG + Intronic
1082078981 11:47997218-47997240 AGGGGACATCTGCCAATATCTGG - Intronic
1082763352 11:57147420-57147442 ATGGGGCACTTGGCAATATCTGG - Intergenic
1082808910 11:57466801-57466823 AGGGGACATTTGGCAATGTCTGG + Intronic
1083032858 11:59610173-59610195 AGGGGACATTTGGCAATGTCTGG - Intronic
1083760607 11:64814847-64814869 AGGGGACATTTGGCAACATCTGG - Intergenic
1084023768 11:66435051-66435073 ATGAGACTTCTGCCAATATTTGG - Intergenic
1084655346 11:70512259-70512281 ATAGGACATTTGGCAGTATCTGG - Intronic
1084789683 11:71465645-71465667 AGGGGACATCTGGTAATGTCTGG - Intronic
1084922450 11:72482140-72482162 AGGGGACATCTGGCAATGTCTGG - Intergenic
1085276667 11:75304601-75304623 AGGGGACACCTGGCAATGTCTGG + Intronic
1086071482 11:82804280-82804302 ATGAGACAACTGGGAAAATGTGG + Intergenic
1086260625 11:84935597-84935619 AGAAGACATTTGGCAATGTCTGG + Intronic
1087140638 11:94762357-94762379 AGGGGACATTTGGCAATGTCTGG + Intronic
1087283684 11:96241430-96241452 AGGAGACATTTGGCAATGTCTGG + Intronic
1087297699 11:96396861-96396883 AGGGGACATCTGGCAATGTGTGG - Intronic
1087308492 11:96512233-96512255 AAAAGACATCTGGTAATATCTGG - Intergenic
1087835311 11:102868338-102868360 AGGAGATATCTGACAATGTCTGG - Intronic
1088136623 11:106563231-106563253 AGGAGACAATTGGCAATGTCTGG + Intergenic
1088204751 11:107379281-107379303 TTGGGACATCTGGCAATATCTGG + Intronic
1088249485 11:107850402-107850424 AGAAGACATTTGGCAATGTCTGG + Intronic
1088360330 11:108982693-108982715 ATAAGACAACAGGCAAGATCTGG - Intergenic
1089310965 11:117557861-117557883 AGGAGACATATGGCAATGTGTGG + Intronic
1089453641 11:118613237-118613259 TTGAGACATCTGGAGATAGCAGG + Intronic
1089709772 11:120306566-120306588 CTGGGACATTTGGCAATGTCTGG - Intronic
1090479763 11:127057769-127057791 AAGGGACATTTGGCAATGTCTGG - Intergenic
1090602079 11:128383395-128383417 AGAGGACATTTGGCAATATCTGG + Intergenic
1090829637 11:130411953-130411975 AGGGGACATTTGGCAATGTCTGG + Intronic
1091331782 11:134736454-134736476 AAGGGACATTTGGCAATGTCTGG - Intergenic
1091428519 12:412618-412640 CAGAAACATCTGGCAATGTCTGG - Intronic
1091656649 12:2351253-2351275 AGGGGACATTTGGCAGTATCTGG - Intronic
1091728548 12:2863097-2863119 AGGGGACATTTGGCAATGTCTGG + Intronic
1091798845 12:3312097-3312119 AGGGGACATTTGGCAATGTCTGG + Intergenic
1091953776 12:4618702-4618724 AGGGGACATTTGGCAATGTCTGG - Intronic
1092362887 12:7852695-7852717 AGTGGACATTTGGCAATATCTGG - Intronic
1092726007 12:11486125-11486147 ATGAGACATCAATCAATATGCGG - Intronic
1092907506 12:13115334-13115356 AGGAGAAATCTGGCAAAATGTGG - Intronic
1092910769 12:13142994-13143016 ATGATAGATCTGGCCATTTCGGG - Intergenic
1093238849 12:16643430-16643452 CTGGGACATTTGGCAATGTCTGG - Intergenic
1093750919 12:22799203-22799225 AGGGGACACTTGGCAATATCGGG - Intergenic
1093856564 12:24111140-24111162 GTGGGACATTTGGCAATGTCTGG - Intergenic
1093957819 12:25241812-25241834 AGGGGACATTTGGCAACATCTGG - Intronic
1094630157 12:32166079-32166101 CTGGGACATTTGGCAATGTCTGG + Intronic
1095155657 12:38850657-38850679 CTGAGAGATCTGGCAAGATGAGG - Intronic
1095559149 12:43545024-43545046 AGAAGACATTTGGCAATGTCTGG - Intronic
1095688224 12:45059962-45059984 AGGGGACATTTGGCAATGTCTGG + Intergenic
1096439609 12:51629446-51629468 AGGGAACATCTGGCAATGTCTGG - Intronic
1096970289 12:55660016-55660038 AGGGGACATTTGGCCATATCTGG - Intergenic
1099023161 12:77431971-77431993 AGGTGACATTTGGCAATGTCTGG + Intergenic
1099070008 12:78034263-78034285 AAGGGACATTTGGCAATATCTGG - Intronic
1099297727 12:80850541-80850563 AGGAGACATTTGGCAATGTCTGG + Intronic
1099305470 12:80949613-80949635 ATGATATATTTGTCAATATCAGG - Intronic
1100223289 12:92530347-92530369 AAGGGACATTTGGCAATGTCTGG - Intergenic
1100483051 12:94997913-94997935 AGGGGACATTTGGCAATGTCTGG + Intronic
1100494769 12:95114228-95114250 AGGGTACATCTGGCAATGTCTGG + Intronic
1100611940 12:96197248-96197270 AGGAGACATTTGGCAATGTCTGG + Intronic
1100682058 12:96935669-96935691 AGGGGACATCTGACAATGTCTGG - Intronic
1100977556 12:100138071-100138093 ATGAGACATTTGGCAATGTCTGG + Intronic
1101099247 12:101375354-101375376 AGGTGACATTTGGCAATGTCTGG + Intronic
1101945701 12:109134755-109134777 ATGGGACATTTGTCAATGTCTGG + Intronic
1102068479 12:109998778-109998800 AGACGACATTTGGCAATATCTGG + Intergenic
1102137308 12:110586135-110586157 AGGGGACATTTGGCAATATCTGG - Intergenic
1102559073 12:113749289-113749311 AGGAGACATCTGGCAATGTCTGG + Intergenic
1102706732 12:114887562-114887584 AGGGGACATCTGGCAATGCCCGG + Intergenic
1102749715 12:115281767-115281789 AGGGGACATTAGGCAATATCTGG + Intergenic
1102791751 12:115652204-115652226 AAGGGACATTTGGCAATGTCTGG + Intergenic
1102798189 12:115707703-115707725 AAAGGACATTTGGCAATATCTGG + Intergenic
1103010883 12:117457348-117457370 AGGGGACATCTGGCAATGTCTGG + Exonic
1103027455 12:117585003-117585025 AGGGGATATCTGGCAATGTCTGG + Intronic
1103068134 12:117917127-117917149 AGGGGACATTTGGCAACATCTGG - Intronic
1103101800 12:118182505-118182527 AGGGAACATTTGGCAATATCTGG - Intronic
1103137222 12:118518094-118518116 AAGAGAATTCTGGAAATATCTGG - Intergenic
1103413178 12:120726908-120726930 AAGGGACATCTGGCAATGTCTGG - Intronic
1103807925 12:123588668-123588690 AGGGGATATTTGGCAATATCTGG + Intronic
1104009152 12:124916892-124916914 AGGGGACATTTGGCAATATCTGG + Intronic
1104063676 12:125288785-125288807 GGGGGACATCTGGCAATATCTGG - Intronic
1104409131 12:128543594-128543616 CAGAGACATTTGGCAATGTCTGG - Intronic
1104488045 12:129168788-129168810 AGGGGACATTTGGCAATATCTGG - Intronic
1104543528 12:129688958-129688980 TGGGGATATCTGGCAATATCTGG + Intronic
1104617066 12:130279644-130279666 ATGAGACATTTTACAATCTCGGG - Intergenic
1104617664 12:130283994-130284016 CAGGGACAACTGGCAATATCCGG - Intergenic
1104781604 12:131424256-131424278 ATCAGACATGTGGATATATCAGG + Intergenic
1104884912 12:132101056-132101078 AGGGGACATCAGGCAATGTCTGG - Intronic
1105810972 13:23994965-23994987 AGGGGACATCTGGCAGTGTCTGG + Intronic
1106136475 13:26977330-26977352 AGGAGGCATTTGGCAATATCTGG - Intergenic
1106375109 13:29178605-29178627 AAGGGACATCTGGCAGTATCTGG - Intronic
1106463718 13:29994559-29994581 GTGAGAAAACTGGCAATCTCTGG + Intergenic
1106510164 13:30406334-30406356 AGGAGACATTTGGCAATGTCAGG - Intergenic
1106695673 13:32170090-32170112 TTGGGATATCTGGCAATGTCTGG - Intronic
1107695382 13:42994497-42994519 AGCAGACATCTGGCAATGCCTGG + Intergenic
1107748154 13:43534719-43534741 AGGAGACATGTGGCAATTTCTGG + Intronic
1108250702 13:48565003-48565025 AGGAGACATTTGGCAATTCCTGG + Intergenic
1108603428 13:52014500-52014522 ATTTGGCATTTGGCAATATCTGG + Intronic
1108700568 13:52940653-52940675 CTGAGCCATCTGGTAATGTCTGG + Intergenic
1108746435 13:53399717-53399739 ATGAGATGTCTGGCAATGTTGGG + Intergenic
1108753811 13:53475920-53475942 AGGGTACATTTGGCAATATCTGG + Intergenic
1108972826 13:56399039-56399061 TGGAGATATCTGGCAATATTTGG + Intergenic
1109351381 13:61186994-61187016 AGGAGATATTTGGCAATGTCTGG + Intergenic
1109870731 13:68328868-68328890 AAGGGACATTTGACAATATCTGG + Intergenic
1110049323 13:70874489-70874511 AGGAGACATTTGGCAATACGTGG + Intergenic
1110241387 13:73271084-73271106 AGGAGACATGTGGCAATGTCTGG - Intergenic
1110466834 13:75812054-75812076 AGGAGACATTTGGCAATGTCTGG + Intronic
1110505689 13:76283618-76283640 ATGGGACAGTTGGCAATGTCTGG + Intergenic
1110547361 13:76770380-76770402 AGGAATCATTTGGCAATATCTGG + Intergenic
1110646393 13:77890427-77890449 AGGAGACATTTGACAATGTCTGG + Intergenic
1111538634 13:89639929-89639951 AGGATACATTTGGCAATGTCTGG - Intergenic
1111708834 13:91785380-91785402 AGGGGACAGCTGGCAATGTCTGG - Intronic
1112181401 13:97084811-97084833 AGGGGACATCTGACAATGTCTGG + Intergenic
1112182162 13:97094304-97094326 AGGAGACATTTGGAAATGTCTGG - Intergenic
1112716328 13:102190371-102190393 AGGGGACATCTGGTAATGTCTGG + Intronic
1112805041 13:103155478-103155500 AGAAGACATTTGGCCATATCTGG - Intergenic
1112912212 13:104500791-104500813 AAGGGACATTTGACAATATCTGG + Intergenic
1113024639 13:105927169-105927191 ATGAGATATTTGGCAATGTCTGG + Intergenic
1113382260 13:109814469-109814491 AGGGGACATTTGGCAATATCTGG + Intergenic
1114475945 14:22994965-22994987 AGGAGACATTTGGAAACATCTGG - Intronic
1115057458 14:29147472-29147494 AGGAGACATTTGGCAATTTCTGG - Intergenic
1115284058 14:31698478-31698500 AAGAATCATCTGGCAATCTCTGG - Intronic
1115327804 14:32161835-32161857 ATGAGACAGCTGTAAATATCTGG - Intergenic
1115439064 14:33411150-33411172 AGGAGACATTTGGCAATGTCTGG + Intronic
1116283357 14:42939413-42939435 AGGGGACATTTGGCAATATGCGG + Intergenic
1116672949 14:47866960-47866982 ATGGTACATATGGCAATGTCTGG + Intergenic
1117155649 14:52937701-52937723 ATGAGACGTGTGGGAATATAAGG - Intronic
1117240000 14:53821423-53821445 TTGGAACATCTGACAATATCGGG + Intergenic
1117455231 14:55890364-55890386 GTGGGACATCTGGCAATGTCTGG - Intergenic
1117515110 14:56492948-56492970 AGGGGACATTTGGCAATGTCTGG + Intronic
1117549714 14:56822412-56822434 AGGGGACATTTGGCAATGTCTGG + Intergenic
1117777748 14:59199887-59199909 AGGGGACATTTGGCAATGTCTGG - Intronic
1117897584 14:60504087-60504109 AGGGGACATTTGTCAATATCTGG - Intronic
1117944277 14:61001118-61001140 ATGGGGCATTTGGCAATGTCTGG + Intronic
1118376732 14:65184095-65184117 ATGAGTCACGTGGAAATATCTGG - Intergenic
1118389784 14:65286633-65286655 AGGGGACATTTGGCAATATGTGG - Intergenic
1118432566 14:65734975-65734997 ATCTGGCATCTGGCAATGTCTGG - Intronic
1118729001 14:68653629-68653651 AGGAGACATTTGGCAATGGCTGG - Intronic
1118804863 14:69227231-69227253 AAGAGACATTTGGCAATATCTGG - Intronic
1118980513 14:70712536-70712558 AAGAGACATTTGGCAATGTTGGG + Intergenic
1119055284 14:71413185-71413207 AGGTGACATCTTGCAACATCTGG - Intronic
1119164276 14:72479499-72479521 AGGGGACATTTGGCAATGTCTGG - Intronic
1119224311 14:72933179-72933201 AGGGGACATCTGGCAATGTCTGG - Intronic
1119354210 14:73991761-73991783 AGCAGACAGCTGGCAATGTCTGG - Intronic
1119591497 14:75892502-75892524 AGGAGACATTTGGCAATATCTGG + Intronic
1120354924 14:83420064-83420086 AAGAGACATTAGGCAATGTCTGG - Intergenic
1120386490 14:83853086-83853108 AGGAGATATTTGGCAATGTCTGG + Intergenic
1120475487 14:84981704-84981726 AGGAGAAGTCTGGCAATGTCTGG - Intergenic
1120496638 14:85246000-85246022 ATGGGACACCTGGCAATGTCTGG - Intergenic
1120956572 14:90088615-90088637 ATGGAAAATCTGGCAATGTCAGG + Intronic
1121768152 14:96505299-96505321 AGGGCACATCTGGTAATATCTGG - Intronic
1121788220 14:96679155-96679177 AGGAGACATTTGGCAATGTTTGG + Intergenic
1122171334 14:99877885-99877907 CCAAGACATCTGGCAATGTCTGG - Intronic
1122302985 14:100742168-100742190 AGGAGACATTTGGCAATGTCTGG + Intergenic
1123667548 15:22619848-22619870 ATGGGACGTTTGGAAATATCTGG - Intergenic
1124084853 15:26538645-26538667 AGGGGACATTTGGCAATGTCTGG + Intergenic
1124321392 15:28714411-28714433 ATGGGACGTTTGGAAATATCTGG - Intronic
1124522486 15:30416233-30416255 ATGGGACGTTTGGAAATATCTGG - Intergenic
1124536178 15:30549981-30550003 ATGGGACGTTTGGAAATATCTGG + Intergenic
1124762474 15:32457610-32457632 ATGGGACGTTTGGAAATATCTGG - Intergenic
1124776154 15:32591461-32591483 ATGGGACGTTTGGAAATATCTGG + Intergenic
1126056576 15:44735531-44735553 AGGAGACATTTGGCAATGACTGG + Intronic
1126576909 15:50206254-50206276 AAGAGACATTTGGCAGTTTCTGG - Intronic
1126671061 15:51115296-51115318 AGGAGACATTTGGCAATATATGG - Intergenic
1126724293 15:51615567-51615589 AGGAGACATTTGGCAGTGTCTGG - Intronic
1126744373 15:51811332-51811354 TTGAGATATTTGGCAATATCTGG + Exonic
1127095263 15:55506534-55506556 AGAAGACATTTGGCAATGTCTGG - Intronic
1127135048 15:55911166-55911188 AGGGGACATCTGGCAATGTCTGG + Intronic
1127389780 15:58496153-58496175 ATGGGACATTTGGCAATATCTGG + Intronic
1127992245 15:64128905-64128927 AGGGGACATTTGGCAATGTCTGG - Intronic
1128219998 15:65962346-65962368 CTGGGACATCCGGCAATGTCTGG + Intronic
1128236110 15:66068446-66068468 AGGGGACATTTGGCAATGTCTGG - Intronic
1128254710 15:66188170-66188192 AGGAGACATTTGACAATCTCTGG - Intronic
1128570191 15:68728101-68728123 AGGGGACATTGGGCAATATCTGG - Intergenic
1128645893 15:69378777-69378799 AGGGGACATCTGACAATATCTGG + Intronic
1128685224 15:69679466-69679488 GGGAGACATTTGGCAATATCAGG + Intergenic
1128709603 15:69861762-69861784 ATGGGACATTTGGTAATGTCTGG - Intergenic
1128828057 15:70739394-70739416 AAGAGACATTTGGCAATGTCTGG - Intronic
1129485244 15:75864318-75864340 GTGGGACATTTGGAAATATCTGG + Intronic
1129504149 15:76067016-76067038 AGGGGACATTTGGCAATTTCTGG - Intronic
1129923608 15:79341804-79341826 AGGAGACATTTGACAATGTCTGG + Intronic
1129929821 15:79401460-79401482 AGGGGACATTTGGCAATGTCTGG + Intronic
1129971097 15:79778789-79778811 ATGGGACATTTGGCAATGTCTGG - Intergenic
1130192933 15:81753578-81753600 AGGAAACATCTGGCAATGTCTGG + Intergenic
1130265299 15:82396106-82396128 ATGGGACATTTGGAAATATCTGG + Intergenic
1130384983 15:83403336-83403358 AGGGGATATCTGGCACTATCTGG + Intergenic
1130475577 15:84263440-84263462 ATGGGACATTTGGAAATATCTGG + Intergenic
1130482995 15:84377494-84377516 ATGGGACATTTGGAAATATCTGG + Intergenic
1130506713 15:84550776-84550798 ATGGGACATTTGGAAATATCTGG - Intergenic
1130607299 15:85329521-85329543 AGTTGACATCTGGCAATGTCTGG + Intergenic
1130717372 15:86348431-86348453 AGGAGACTTTTGGCAATGTCTGG + Intronic
1130756533 15:86770329-86770351 AGGAGACATTTGGCAATGTCTGG + Intronic
1130759486 15:86803774-86803796 AAGAGACATTTGACAATGTCTGG + Intronic
1130774472 15:86964433-86964455 AGGAGACATTTGGCCATGTCTGG - Intronic
1130842364 15:87712974-87712996 AGGTGACATTTGGCAATTTCTGG + Intergenic
1130898376 15:88188340-88188362 AGCAGACATTTGACAATATCTGG + Intronic
1130913436 15:88286643-88286665 AGGAGACATTTGACAATATCTGG + Intergenic
1131256675 15:90867475-90867497 AAGGGACATTTGGCAATACCTGG + Intergenic
1131548550 15:93336398-93336420 AAGAGACACTTGGCAATGTCTGG + Intergenic
1131922583 15:97345804-97345826 AGCAGACATTTGGCAATATCTGG - Intergenic
1132320815 15:100923874-100923896 AGGGGACATTTGGCAATGTCTGG - Intronic
1132418641 15:101644288-101644310 AGGGGACACCTGGCAACATCTGG + Intronic
1133140882 16:3743116-3743138 AGGGGACATCTGGCAATGTCTGG + Intronic
1133305571 16:4806114-4806136 AGGGGACATCTGGTAATATCTGG + Intronic
1133422804 16:5661490-5661512 GTGAGACAACTGGGAAAATCTGG - Intergenic
1133542662 16:6771642-6771664 AGGAGACATTTGGCAATGTCAGG + Intronic
1133548441 16:6830525-6830547 AGGGGACAGCTGGCAATATCTGG + Intronic
1133728077 16:8555714-8555736 AGGGGACACCTGGCAATATCTGG + Intergenic
1134028687 16:10974569-10974591 AGGGGACATTTGGCAATGTCTGG - Intronic
1134221351 16:12356886-12356908 AGAGGACATCTGGCGATATCTGG - Intronic
1134317482 16:13132580-13132602 AGGGGACATCTGGCAATGTCAGG - Intronic
1134331175 16:13252307-13252329 AGGGGACATTTGGCAATAACTGG + Intergenic
1134416654 16:14049024-14049046 AGGGGACATTTGGCAATGTCTGG + Intergenic
1134530215 16:14976646-14976668 AGGAGACATTTGGCTATCTCTGG + Intronic
1134557131 16:15174962-15174984 AAGGGACATTTCGCAATATCGGG + Intergenic
1134567394 16:15263330-15263352 AAGGGACATTTGGCAATGTCTGG - Intergenic
1134659497 16:15973313-15973335 AGGGGACATTTGGCAATGTCTGG + Intronic
1134665527 16:16015820-16015842 AGGAAACATCTGGCAGTGTCTGG - Intronic
1134673633 16:16074239-16074261 AAGGCACATCTGGCAATGTCTGG - Intronic
1134735099 16:16493370-16493392 AAGGGACATTTGGCAATGTCTGG + Intergenic
1134818537 16:17226803-17226825 CAGGGACATTTGGCAATATCTGG - Intronic
1134917710 16:18086673-18086695 AAGGGACATTTCGCAATATCGGG + Intergenic
1134932423 16:18218847-18218869 AAGGGACATTTGGCAATGTCTGG - Intergenic
1135029298 16:19025194-19025216 AGGAAACATTTGGCAATCTCTGG - Intronic
1135670735 16:24373490-24373512 AGGAGACATTTGGCAATGTCTGG - Intergenic
1135712883 16:24732800-24732822 CAGGGACATCTAGCAATATCTGG - Intronic
1135885758 16:26305727-26305749 AGGGGACATTTAGCAATATCTGG - Intergenic
1136031341 16:27505493-27505515 AGGAGACATTTCGCAATATCTGG - Intronic
1137643682 16:50056140-50056162 GTGGGACATTTGGCAATGTCTGG - Intergenic
1137939450 16:52669291-52669313 AGGAGATATTTAGCAATATCTGG + Intergenic
1138116106 16:54361955-54361977 GTGAGCTATCTGGCAATGTCAGG - Intergenic
1138148571 16:54634545-54634567 AGGGGACATTTGGCAATGTCTGG + Intergenic
1138153343 16:54679667-54679689 AGGGGACATTTGGCAATGTCTGG + Intergenic
1138879369 16:60992004-60992026 ATAAGACAACTGGCAATGTCTGG + Intergenic
1139086689 16:63595511-63595533 ATGGGACATTTGGTAATGTCTGG + Intergenic
1139124343 16:64059420-64059442 AGGAGACATTTGGCAATATCTGG - Intergenic
1139639574 16:68281316-68281338 AGGAGACATTTAGCAATATCTGG + Intronic
1139718786 16:68836201-68836223 ATGTGACATTTTGCAATTTCTGG + Intergenic
1140524803 16:75613750-75613772 AGGAGACTTTTGGCAACATCTGG - Intronic
1140676095 16:77331616-77331638 ATAGGACATTTGGCAATGTCTGG + Intronic
1140734796 16:77888724-77888746 AGGAGACATTTGACAATGTCTGG - Intronic
1140752983 16:78043009-78043031 AGATGACATTTGGCAATATCTGG - Intronic
1140767124 16:78170144-78170166 AAGAGACATCTGGCAATGCCTGG - Intronic
1140962512 16:79930157-79930179 ATGAGGCAAGTGGCAATGTCTGG + Intergenic
1140977076 16:80070290-80070312 AAGACACATCTGGCATTCTCAGG - Intergenic
1141022499 16:80510706-80510728 CGGGGACATTTGGCAATATCTGG - Intergenic
1141567445 16:84912551-84912573 CTGAGACAACTGGTAAAATCTGG - Intronic
1141649255 16:85384472-85384494 CTGACACATCTGGCAAGGTCTGG - Intergenic
1141667233 16:85472102-85472124 AGGAGACACCTGGCAATGTCTGG - Intergenic
1141746711 16:85931057-85931079 TTGGGACATCTGGCCATGTCTGG + Intergenic
1203141270 16_KI270728v1_random:1768377-1768399 AGGAGATATTTTGCAATATCTGG - Intergenic
1142502960 17:343675-343697 AAGAGACATTTGGAAATATCTGG + Intronic
1143872672 17:9968636-9968658 AAGGGACATTTGGCAACATCTGG - Intronic
1144738907 17:17570378-17570400 AAGGGACATCAGGCAATGTCTGG + Intronic
1146427606 17:32757319-32757341 AGGGGACATTTGGCAATATCAGG + Intronic
1146817912 17:35958896-35958918 AGGAAACATTTGGCAATTTCTGG + Intergenic
1147855117 17:43473919-43473941 AGGGGACATCTGGCCATGTCTGG + Intergenic
1148179601 17:45594690-45594712 AAGTGACATTTGGCAATATCTGG - Intergenic
1148269305 17:46251208-46251230 AAGTGACATTTGGCAATATCTGG + Intergenic
1148499134 17:48075904-48075926 AAGAGACAGCTGCTAATATCAGG + Intronic
1148813862 17:50312829-50312851 ATGGGACATTTGGCAATGTCTGG - Intergenic
1149963337 17:61136523-61136545 AGGGGACATTTGGCAATATTTGG - Intronic
1150198316 17:63325199-63325221 AGGAAACATTTGGCAATTTCTGG - Intronic
1150261682 17:63797602-63797624 AGGCAACATCTGGCAATGTCTGG - Intronic
1150312622 17:64141349-64141371 AGGGAACATTTGGCAATATCTGG - Intergenic
1150713072 17:67548082-67548104 AGGAGACACCTGGCAATGTCTGG - Intronic
1150724265 17:67638719-67638741 CAGGGCCATCTGGCAATATCTGG + Intronic
1150767433 17:68013287-68013309 AAGTAACATTTGGCAATATCTGG - Intergenic
1150962884 17:69934303-69934325 AAGAGACATTTAGCAATGTCTGG - Intergenic
1150977160 17:70101137-70101159 AAGGGACATCTGGCAATGTCTGG + Intronic
1151099828 17:71544211-71544233 AGGGGACATTTGGCAATGTCTGG - Intergenic
1151286856 17:73118454-73118476 AGGAGACATCGGGCAATGTCTGG - Intergenic
1151692503 17:75695306-75695328 AGGGGACATTTGGCAATGTCTGG - Intronic
1153446246 18:5176043-5176065 AGGGGACATTTGGCAATGTCTGG - Intronic
1153510860 18:5850562-5850584 AAGGGATATCTGGCAATGTCTGG + Intergenic
1153675678 18:7454214-7454236 AAGGGACATTTGGCAATGTCCGG - Intergenic
1154369506 18:13746731-13746753 AGGGGACATTTGGCAATGTCTGG - Intronic
1155007887 18:21745424-21745446 AGGGGACATCTGGCAATGTCTGG - Intronic
1155859390 18:30878003-30878025 AGGAAACATTTGGCAGTATCTGG + Intergenic
1155931995 18:31718203-31718225 AGGGGACATTTGGCAATGTCTGG + Intergenic
1156425681 18:37009511-37009533 AGGAGAAATTTGGCAATATCTGG + Intronic
1157005541 18:43579545-43579567 ATGGGACATTTGGTAATGTCTGG + Intergenic
1157130612 18:45003939-45003961 AGGAGACTTTTGGCAATGTCTGG + Intronic
1157515939 18:48311441-48311463 AGGAGACATTTGGCAATGTCTGG + Intronic
1157882247 18:51331583-51331605 ATGGGACATTTGGCAATATCTGG - Intergenic
1158208819 18:55023758-55023780 AGGTGACATTTGGCAATATCTGG + Intergenic
1158235751 18:55311451-55311473 AGGGGACATACGGCAATATCTGG - Intronic
1158305510 18:56101139-56101161 AGGGGACATTTGGCAAGATCTGG + Intergenic
1158395378 18:57075343-57075365 AGAGGACATCTGGCAACATCTGG - Intergenic
1158837111 18:61342647-61342669 ATTTGACATTTGGCAATGTCTGG - Intronic
1159928376 18:74289437-74289459 AGGGGACCTCTGGCAATATCTGG + Intronic
1160584883 18:79907729-79907751 AGGAAACATCTGGCAATTCCTGG + Intronic
1161142205 19:2654479-2654501 AGGGGACATCAGGCAATGTCTGG - Intronic
1161144397 19:2668918-2668940 AGGGGACATTTGGCAATGTCTGG - Intronic
1161408818 19:4104960-4104982 AGGAGACACCTGGCACTGTCTGG - Intronic
1161548329 19:4895936-4895958 AAGGGACATTTGGCAATGTCTGG - Intronic
1161834360 19:6635597-6635619 AGGAAACATTTGGCAACATCTGG + Intergenic
1161859727 19:6789061-6789083 AGGGGACATTTGGCAATGTCTGG - Intronic
1161915616 19:7225803-7225825 AGGAGACACCTGGCAGTGTCTGG + Intronic
1161918853 19:7251167-7251189 AGGGGACATTTGGCAATGTCTGG - Intronic
1162201119 19:9020972-9020994 AGGGGACAGTTGGCAATATCTGG - Intergenic
1162404515 19:10465554-10465576 AGGGGACATTTGGCAATGTCTGG - Intronic
1163054739 19:14709884-14709906 AGGGGACATTTGGCAATGTCTGG - Intronic
1163074354 19:14875924-14875946 ATGAGACACTTGGAAATGTCTGG + Intergenic
1163151435 19:15417529-15417551 AGATGACATCTGGCAATGTCTGG - Intronic
1163165964 19:15498544-15498566 GAGAGAAAACTGGCAATATCTGG - Intronic
1163336103 19:16672864-16672886 AGGATAAATTTGGCAATATCTGG + Intronic
1163358907 19:16833051-16833073 GGGAGACACCTGGCAATGTCTGG - Intronic
1164684195 19:30156345-30156367 CTGGGACATTTGGCAATGTCTGG + Intergenic
1164782547 19:30905122-30905144 TAGAGACATCTGGCAATCTCTGG + Intergenic
1165526865 19:36363537-36363559 AAAAGACATCCGGCCATATCTGG + Intronic
1166417430 19:42606521-42606543 AGGGGGCATCTGGCAATGTCCGG + Intronic
1167045009 19:47044709-47044731 AGGAGACACCTGGCAATATCTGG - Intronic
1167560151 19:50222129-50222151 AGGAGACACCTGGCAATGTCTGG - Intronic
1167820164 19:51920561-51920583 AGGTGACATTTGGCAATGTCTGG - Intronic
1168260833 19:55193521-55193543 AAGAGACACCGGGCAATGTCTGG + Intronic
1168411416 19:56142442-56142464 AGGGGACATGTGGCAATGTCTGG + Intronic
1168435470 19:56313958-56313980 AGGGGACATTTGGCAATGTCTGG + Intronic
1168484191 19:56747170-56747192 AGGAGACATCTGCCAATTTTTGG - Intergenic
1168490558 19:56805231-56805253 AGGGGACATGTGGCAATGTCTGG - Intronic
925528418 2:4831537-4831559 AGGGGACATTTGGCAATTTCTGG + Intergenic
925953966 2:8942847-8942869 AAGAGACATGTGAAAATATCTGG + Intronic
926689426 2:15722984-15723006 AGAGGACATCTGGCAGTATCTGG - Intronic
927085835 2:19673302-19673324 AGGGGACATTTGGCAATGTCTGG - Intergenic
927934458 2:27068380-27068402 AGGTGACATCAGGCAACATCTGG + Intronic
928241931 2:29593985-29594007 ATGGGACATTTGGCAATATCTGG + Intronic
928601197 2:32905078-32905100 ATGAACAATCTGGCACTATCAGG - Intergenic
928621176 2:33089405-33089427 ACGTGACATGTGGCAATGTCTGG + Intronic
929031975 2:37657757-37657779 ATGCGATATTTGGCAATGTCTGG + Intronic
929207889 2:39318954-39318976 AGGAGACATTTGGCAATATCTGG + Intronic
929263374 2:39891796-39891818 AACTGACATGTGGCAATATCTGG - Intergenic
929386209 2:41410161-41410183 AGAAAACATTTGGCAATATCTGG + Intergenic
929392054 2:41480876-41480898 AGAAGACATTTGGCAATGTCTGG - Intergenic
929419130 2:41773093-41773115 AGGGGGCATCTAGCAATATCCGG - Intergenic
929535627 2:42782478-42782500 ATGAGACATCAGACAAAACCTGG + Intronic
929894792 2:45950347-45950369 ATGGGACATCAGCCAATCTCTGG + Intronic
930325805 2:49915679-49915701 AGGAGACATTTGGTAATGTCAGG - Intergenic
930619488 2:53629151-53629173 ATGAGACATGAGACAACATCTGG - Intronic
930907886 2:56594925-56594947 AGGGGACATTTGGCAATATTTGG - Intergenic
931225962 2:60332552-60332574 AGGGAACATCTGGCAGTATCTGG + Intergenic
931410936 2:62030522-62030544 AGGAGACACTTGGCAATGTCTGG - Intronic
931412780 2:62049425-62049447 AGGGGACATTTGGCAATGTCTGG + Intronic
931525713 2:63150324-63150346 AGGAGACATTTGGCAATGTCTGG + Intronic
931730468 2:65148649-65148671 CTGAAACATTTGGCAATGTCTGG - Intergenic
931780625 2:65576563-65576585 AAGGGATATTTGGCAATATCTGG + Intergenic
932056648 2:68452253-68452275 AGGAGACATTTGGCAATGTCTGG + Intergenic
932882164 2:75512858-75512880 AGGGGACTTCTGGCAATGTCTGG - Intronic
933200156 2:79438618-79438640 AGGGGACATTTGGCAATGTCAGG - Intronic
933252726 2:80047049-80047071 AGGGGACATCTGGCAATGTCTGG - Intronic
933565917 2:83950403-83950425 AGGGGATATCTGGCAATATCTGG + Intergenic
933687734 2:85156843-85156865 AGGAGACATTTGGCAATGCCTGG + Intronic
933704580 2:85280185-85280207 AGGAGACATTTGGCAAAATCTGG + Intronic
935050218 2:99518844-99518866 AGGAGACATTTGGCAATGTCTGG + Intergenic
935655957 2:105423420-105423442 ATGAAACTTCTGACAATATCAGG + Intronic
935948054 2:108303822-108303844 AGGGGACATTTGGCAATGTCTGG - Intronic
936489632 2:112958948-112958970 AGGGGACATTTGGCAATATCTGG + Intergenic
937291132 2:120782808-120782830 AAGGGACATTTGGCAATATCTGG - Intronic
937494488 2:122403275-122403297 AGGAAACATTTGGCAATGTCTGG - Intergenic
937880844 2:126863423-126863445 AGGAGACATTTGGCAATGTTTGG - Intergenic
939025724 2:137011540-137011562 AAGAGACATTTGGCAATGTCGGG - Intronic
939295626 2:140260667-140260689 ATGGGCCATCTGGCTATATAGGG - Intronic
939563489 2:143759157-143759179 ATGAGAGATTTGGCAATATCTGG - Intronic
940677287 2:156740030-156740052 AAGGGACATTTGGCAATGTCTGG + Intergenic
941114281 2:161453614-161453636 AGGGAACATCTGACAATATCTGG + Intronic
941620919 2:167777871-167777893 AGGGGACATATGGCAATGTCTGG + Intergenic
941666784 2:168250270-168250292 AGGGGACATTTGGCAATGTCTGG - Intergenic
941744647 2:169073921-169073943 AGGGGACATTTGGCATTATCTGG + Intronic
941807034 2:169719740-169719762 AGGAGATATGTGGCAGTATCTGG - Intronic
942257783 2:174123142-174123164 ATGATGCATCTGGGTATATCTGG + Intronic
942600568 2:177636806-177636828 AGAGGACATCTGGCAATATCTGG - Intronic
943260458 2:185653567-185653589 ATGAGACATCAATCAATATGTGG + Intergenic
943664827 2:190598165-190598187 AGGAAACATTTGGCAATGTCTGG - Intergenic
943734878 2:191343126-191343148 AGGGGACATCTGACAATGTCTGG - Intronic
943861880 2:192876503-192876525 ATAAGACATCTTGCAATAATTGG + Intergenic
944405212 2:199376438-199376460 ATGGGACCTTTGGCAACATCTGG + Intronic
944612100 2:201421541-201421563 AGGGGACATCTGACAATGTCTGG - Intronic
944651834 2:201838204-201838226 AGGGGACATTTGGCAATGTCTGG + Intronic
945014148 2:205497516-205497538 ATGAGATATCTGATAATATGAGG - Intronic
945608178 2:211963155-211963177 AGAAGACATCTGGCAATGTCTGG + Intronic
945635584 2:212345403-212345425 AGGAGACATTTAGCAATGTCTGG + Intronic
945878672 2:215304668-215304690 AGGAGACATTTGGCAATGTCTGG + Intergenic
945903694 2:215567291-215567313 AGGAGACATTTGACAATGTCTGG - Intergenic
945939453 2:215933519-215933541 AGGGGACATTTGGCCATATCTGG - Intergenic
946101261 2:217326480-217326502 AGGGGACATTTGGCAATGTCTGG - Intronic
946102400 2:217337257-217337279 AGGGGACATTTGGCAATCTCTGG + Intronic
946288447 2:218723888-218723910 ATGGGACAGTTGGCAATATTTGG + Intronic
946697167 2:222371566-222371588 AGTGGACATTTGGCAATATCTGG - Intergenic
946763938 2:223022594-223022616 ATGGGACATTTGGCCATGTCTGG - Intergenic
947134427 2:226963107-226963129 AGGAGACAACTGGCAACATCTGG - Intronic
947340534 2:229134067-229134089 AGGGGACATCTGGCAATGTCTGG - Intronic
947378091 2:229517702-229517724 AGAAGACATTTGGCAATGTCTGG + Intronic
947543401 2:230993840-230993862 AGGGGACATTTAGCAATATCTGG + Intergenic
1169359239 20:4934236-4934258 AGGGGACATCTGGCAATGTCTGG + Intronic
1169733848 20:8815334-8815356 GACAGACTTCTGGCAATATCTGG + Intronic
1170599490 20:17830182-17830204 AAAAGACATGTGGAAATATCTGG + Intergenic
1170908133 20:20535351-20535373 AGGAGACATTTGGCAGTGTCTGG - Intronic
1171021482 20:21588166-21588188 AGGAGACATTTGGGAATGTCTGG + Intergenic
1171330710 20:24336411-24336433 ATTACACACCTGACAATATCTGG - Intergenic
1172681305 20:36717814-36717836 CAGGGACATCTGGCAATGTCTGG + Intronic
1173077949 20:39838850-39838872 AGGTGACATCTGGCAATGTCTGG - Intergenic
1173196212 20:40914883-40914905 AGGATACATCTGACAGTATCTGG - Intergenic
1173359972 20:42334323-42334345 AAGAGATATCTGGCAATGTCAGG - Intronic
1173403552 20:42745509-42745531 AGGGGACATTTGGCAATGTCTGG - Intronic
1173533170 20:43786422-43786444 AGGAGACATTTGACAATCTCTGG + Intergenic
1173865741 20:46311672-46311694 AGGAGACATTTGGCAATGTCAGG - Intergenic
1173907402 20:46638921-46638943 AGGAGACATGTGGCAATGTCTGG - Intronic
1173993619 20:47321329-47321351 AGGGGACATCTGGCAATGTCTGG + Intronic
1174041829 20:47705612-47705634 AGGAGACACTTGGCAATGTCTGG + Intronic
1174200974 20:48806157-48806179 AGGGGACATATGGCAATGTCTGG - Intronic
1174244657 20:49168727-49168749 AGGAGACATCTGCCAATGTCTGG + Intronic
1174270012 20:49361244-49361266 AGGGGACATCTAGCAATTTCTGG + Intergenic
1174276388 20:49407613-49407635 AGGGGACATTTGGCAATGTCTGG + Intronic
1174314441 20:49687066-49687088 AGGGGACATTTGGCAGTATCTGG + Intronic
1174382517 20:50165671-50165693 AGGGGACATTTGGCAATGTCTGG + Intergenic
1174415669 20:50364968-50364990 AGGAGACATGTGGCAATATCTGG + Intergenic
1174588947 20:51630020-51630042 AGGAGACATGTGGCAATGTCTGG + Intronic
1174678223 20:52378185-52378207 GGGGGACATCTGGCAATGTCTGG + Intergenic
1174708883 20:52684590-52684612 AAGGGACATTTGGCAATATGTGG + Intergenic
1174710080 20:52695278-52695300 AGGAGACATTTGGCAATGTCTGG + Intergenic
1174728068 20:52885904-52885926 ATAGGACATTTGGCAATATATGG + Intergenic
1174733159 20:52937998-52938020 AGGGGACATTTGGCAATGTCTGG + Intergenic
1174798732 20:53544553-53544575 ATGGGACATATGGCAATATCTGG - Intergenic
1174826246 20:53771231-53771253 AGAAGACATTTGGTAATATCTGG - Intergenic
1174912608 20:54623143-54623165 AGGAGACATTTGGCAGTATCTGG + Intronic
1175058339 20:56218621-56218643 AGGGGACATGTGGCAATGTCTGG - Intergenic
1175147750 20:56909665-56909687 AGGAGACATCTGGCAACATCTGG - Intergenic
1175166518 20:57048151-57048173 AGGGGACATCTGGCGACATCTGG + Intergenic
1175179796 20:57137747-57137769 AGGGGACATTTGGCAATATCTGG + Intergenic
1175217040 20:57396735-57396757 AGGGGACATTTGGCAATGTCTGG - Intronic
1175261970 20:57680360-57680382 AGGGGACATCTGGCCATATCTGG + Intronic
1175364125 20:58439646-58439668 AGGACACATGTGGCAATATCTGG - Intronic
1175613310 20:60370391-60370413 AGGAGACATTTGGCAACATCTGG + Intergenic
1175784637 20:61704870-61704892 AGGAGACACTTGGCAGTATCTGG - Intronic
1177260509 21:18724160-18724182 AGGAGGCATTTGGCAATGTCTGG + Intergenic
1177289565 21:19093967-19093989 ATGGGACATTTGGCAATGTCTGG - Intergenic
1178679200 21:34658203-34658225 ATGGATCATCTGGCAATGTCTGG - Intergenic
1178712942 21:34935770-34935792 AAGGGACATTTGGCAATGTCAGG - Intronic
1178723900 21:35034561-35034583 AGGGGTCATCTGGCAATGTCTGG + Intronic
1178902384 21:36607604-36607626 AGGGGACATTTGGCAACATCTGG + Intergenic
1178955272 21:37016313-37016335 AGGGGACATTTGGCAATGTCTGG - Intronic
1179191597 21:39126707-39126729 TGGGGACATTTGGCAATATCTGG + Intergenic
1179600365 21:42473880-42473902 AGGGGACATTTGGCAATGTCTGG - Intronic
1181446799 22:22982908-22982930 AGGGGACATATGGCAATCTCCGG - Intergenic
1181626824 22:24128045-24128067 AGGAGGCATCTGGCAATATCTGG - Intronic
1181725961 22:24811099-24811121 AGGGGACATTTGGCAATGTCTGG + Intronic
1181763569 22:25075152-25075174 AAGGGACATTTGGCAATGTCTGG + Intronic
1181884923 22:26013227-26013249 AGGGGACAGCTGGCAATGTCTGG + Intronic
1181908987 22:26222860-26222882 AGGAGATATCTGACAATGTCTGG + Intronic
1181923213 22:26336815-26336837 AGGTGACATTTGGCAATGTCTGG - Intronic
1182012367 22:27011572-27011594 AGGAGACACTTGGCAATGTCTGG - Intergenic
1182023625 22:27100844-27100866 ATGATACAGCTGGCAGCATCTGG + Intergenic
1182220622 22:28755903-28755925 TGGGGACATCTGGCAATGTCTGG - Intronic
1182242707 22:28929463-28929485 AGGGGACATCTGGCAGTGTCTGG - Intronic
1182338144 22:29598887-29598909 AGGGGACATTTGGCAATGTCTGG - Intergenic
1182653114 22:31868221-31868243 AAGGGACATTTGGTAATATCTGG + Intronic
1182654999 22:31883156-31883178 AGGGGACATTTGGCAATGTCAGG - Intronic
1182779419 22:32855765-32855787 TTGGGACATGTGGCAATGTCTGG - Intronic
1182792075 22:32961202-32961224 AGGAGACATTTGGCAATGCCTGG - Intronic
1182880124 22:33725899-33725921 CGGAGACATTTGGCAATGTCTGG + Intronic
1182958188 22:34447000-34447022 AGGAGACATTTGGAAACATCTGG - Intergenic
1183355112 22:37354581-37354603 AGGGGACATTTGGCAATGTCTGG - Intergenic
1183355160 22:37354869-37354891 AGGGGACATTTGGCAATGTCTGG - Intergenic
1183523307 22:38309142-38309164 AGGAGACATATGTCAAGATCTGG - Intronic
1184022329 22:41829128-41829150 AGTGGACATCTGGCAATGTCTGG - Intergenic
1184616960 22:45644983-45645005 AGGGGACATTTGGCAATGTCTGG - Intergenic
1184665988 22:45989359-45989381 GGGAGACATTTGGCAATGTCTGG - Intergenic
949194324 3:1287353-1287375 AGAAGTTATCTGGCAATATCTGG - Intronic
949511031 3:4767366-4767388 AGGGGACAACTGGCAATGTCTGG - Intronic
949596451 3:5552990-5553012 AGGGGACATTTGGCAATGTCTGG - Intergenic
949908491 3:8879661-8879683 AGGAGACAGCTGGCAATGTGTGG - Exonic
950218430 3:11176396-11176418 ATGAGGCATCTGGAAATAGTGGG - Intronic
950275090 3:11653976-11653998 AGGAGACATCTGGCAATGTCTGG + Intronic
950447003 3:13044227-13044249 CAGGGACATCTGGTAATATCTGG + Intronic
950678842 3:14571083-14571105 AGGGGACATTTGGCAATCTCTGG - Intergenic
950760094 3:15214863-15214885 AGGGGACATTTGGCAATTTCTGG + Intronic
950825923 3:15821145-15821167 AGGGGACATTTGGCAATATCTGG - Intronic
951178491 3:19630693-19630715 CGGAGACATTTGGCAATGTCTGG - Intergenic
951437849 3:22685733-22685755 CAGGGACATTTGGCAATATCTGG + Intergenic
951604013 3:24411671-24411693 AAGAGACATTTGGCAATACCTGG + Intronic
951629528 3:24704298-24704320 AGAGGACATCTGGCAATGTCTGG - Intergenic
951665165 3:25114745-25114767 TTGACACCTCTGGCAAGATCAGG + Intergenic
951688632 3:25372341-25372363 AGGGGCCATTTGGCAATATCTGG - Intronic
951729440 3:25794750-25794772 AGAAAACATTTGGCAATATCTGG - Intergenic
951896483 3:27614508-27614530 AGAGGACATTTGGCAATATCTGG + Intergenic
952091519 3:29892499-29892521 AGCAGACATTTGGCAATGTCTGG - Intronic
952161179 3:30694926-30694948 AGGGGACATTTGGCAATGTCTGG - Intergenic
952714043 3:36460517-36460539 AGGGGACATTTGGCAATTTCTGG + Intronic
953222429 3:40984967-40984989 ATGGGACACTTGGCAATGTCTGG + Intergenic
953253613 3:41268031-41268053 AGGAGACATTTGGCAATGTCTGG + Intronic
953342601 3:42148172-42148194 AGGGGACATTTGGCAATGTCTGG + Intronic
954198405 3:49009606-49009628 AGGAGACATCTAGCAATAGCTGG - Intronic
954468223 3:50670270-50670292 CTGACACATCTGGAAACATCTGG + Intergenic
954703090 3:52462383-52462405 GTGGGACATTTGGCAATGTCTGG - Intronic
954713800 3:52517316-52517338 ATGAGACAGCTGTTAATTTCTGG - Exonic
955096782 3:55806567-55806589 AGGTGACATTTGGCAATGTCTGG + Intronic
955149647 3:56354393-56354415 AGGAGACATCTGGCACTGTCTGG + Intronic
955312620 3:57904713-57904735 AGGGGACATTTGGCAATATCTGG + Intronic
955341322 3:58127668-58127690 TTAAGACATCTGGCAAGATATGG - Intronic
955376854 3:58404491-58404513 AGGAGACATTTAGCAATGTCTGG - Intronic
955609269 3:60739681-60739703 GAGAGACATATGGCAATGTCTGG - Intronic
955620739 3:60861504-60861526 AGGTGACATTTGGCAATGTCAGG - Intronic
955675871 3:61448539-61448561 AGGAGATATTTGGCAATGTCTGG + Intergenic
955694200 3:61619387-61619409 AGGGGACATTTGGCAATGTCTGG + Intronic
955703407 3:61704536-61704558 AGGGGACATCTGGCAATACCTGG - Intronic
955837885 3:63077711-63077733 AGGAAACATTTGGTAATATCTGG - Intergenic
955981790 3:64534729-64534751 AGGGGAAATCTGGCAATGTCTGG + Intronic
956018685 3:64911056-64911078 AGGAGACACTTGGCAATGTCTGG - Intergenic
956046266 3:65199373-65199395 AGGAAACATTTGACAATATCTGG - Intergenic
956069837 3:65436734-65436756 CAGAGACATCTGGCAATGTCTGG + Intronic
956089662 3:65652523-65652545 AGGAGACATTTGACAATGTCTGG - Intronic
956090730 3:65663854-65663876 AGGGGACATCTGGCAATGTCTGG - Intronic
956100041 3:65758592-65758614 AGGAGACATCTGGCAACGTCTGG + Intronic
956202306 3:66719155-66719177 AGGGGACATTTGGCAATGTCTGG + Intergenic
956380708 3:68661744-68661766 AGGGCACATTTGGCAATATCTGG - Intergenic
956381470 3:68668713-68668735 AGGTGACATTTGGCAATGTCTGG - Intergenic
956516351 3:70052768-70052790 AGGTGACATTTGGCAATTTCTGG - Intergenic
956587287 3:70878253-70878275 AGGAGACATTTGGCAATATCTGG - Intergenic
956683319 3:71802141-71802163 AGGGGACATTTGGCAATGTCTGG + Intergenic
956700658 3:71955987-71956009 AGGGGACATTTGGCAATGTCTGG + Intergenic
956852865 3:73246868-73246890 AGGAGACACCTGGCAATCTCTGG - Intergenic
956862613 3:73339475-73339497 ATGGAACATGTGGCAAGATCTGG - Intergenic
956886584 3:73566081-73566103 ATGTCACATCTGGAAATTTCAGG - Intronic
957270825 3:78028233-78028255 AAGAGACATTTGGTAATTTCTGG + Intergenic
957867741 3:86046474-86046496 AAGAGACATGTGGCAATGTTTGG + Intronic
958027267 3:88063085-88063107 AGGAGACATTTGGCAATGTCAGG + Intronic
958789430 3:98633866-98633888 AAGAGACATTTGGCAACATCTGG - Intergenic
958816279 3:98919794-98919816 AAGAGACTTGTGGCAATTTCTGG + Intergenic
958898253 3:99854662-99854684 AGGAGACATTTGGCAATGTCTGG - Intronic
959718488 3:109460228-109460250 AGGTGACATTTGGCAATGTCTGG - Intergenic
960086359 3:113595596-113595618 AAAAGACATTTGGCAATGTCTGG - Intronic
960593740 3:119390019-119390041 CAGGGACATCTGGCAATGTCTGG - Intronic
961775684 3:129283146-129283168 CAGAGACTTCTGGCAGTATCTGG - Intronic
962165907 3:133047645-133047667 AGGGGACATTTGGCAATGTCTGG - Intronic
962834464 3:139175019-139175041 AGGGGACATTTGGCAATGTCTGG + Intronic
963151657 3:142051542-142051564 AGGGGACATTTGGCAATATCTGG - Intronic
963205462 3:142629920-142629942 AGAGGACATCTGGCAATGTCTGG - Intronic
963350492 3:144145413-144145435 AAGGGACATTAGGCAATATCTGG + Intergenic
963750162 3:149169645-149169667 AGGGGACATCTGGCAACATCTGG - Intronic
964012318 3:151905489-151905511 AGGGGAAATTTGGCAATATCTGG - Intergenic
964248069 3:154677314-154677336 ATGAGAGATATTGCAATATTAGG + Intergenic
964840171 3:160984851-160984873 ATGGGACATTTGGCAATGTTGGG + Intronic
965402063 3:168223888-168223910 GGGGGACATCTGGCAATGTCTGG + Intergenic
965666955 3:171105410-171105432 AGGAGACATTTGGCAAAATCTGG - Intronic
965882389 3:173401260-173401282 TAGAGACATTTGGCAATGTCTGG - Intronic
966596798 3:181731283-181731305 ATTAGACATGTGCAAATATCAGG - Intergenic
966730393 3:183146145-183146167 AGGAGACATTTGACAATGTCTGG + Intronic
966830189 3:184001533-184001555 AGAGGACATGTGGCAATATCTGG + Intronic
967207153 3:187134299-187134321 TGGAGACATTTGGCAGTATCTGG + Intronic
967479635 3:189958656-189958678 AGTGGACATTTGGCAATATCTGG - Intronic
968351825 3:198063473-198063495 AAGAGACTTCTGGAAATTTCTGG + Intergenic
968685422 4:1954810-1954832 AGGGGACATTTGGCAATGTCTGG + Intronic
969012878 4:4081303-4081325 AGGGGACATTAGGCAATATCTGG + Intergenic
969064806 4:4470337-4470359 AGGGGACATTTGGCAATGTCTGG - Intronic
969136970 4:5037221-5037243 AGGAAACATTTGGCAATGTCTGG - Intergenic
969584255 4:8082973-8082995 AAGAGACATTTGGCAATGTCTGG + Intronic
969863405 4:10055478-10055500 AGGGGACATTTGGCAATGTCTGG - Intergenic
969966308 4:11000425-11000447 AGGAGACATTTGGCAATATCTGG - Intergenic
969995773 4:11311303-11311325 AGGGGACATTTGGCAATGTCTGG - Intergenic
970416911 4:15867207-15867229 ATGACACATCTGGCAATGAAAGG + Intergenic
970550126 4:17171808-17171830 AGGGGACATTTGGCAATATGTGG + Intergenic
970569160 4:17362727-17362749 AGGGAACATCTGGCAATGTCTGG - Intergenic
970723715 4:19017650-19017672 AAGAGATATTTGGCAATATCTGG - Intergenic
971137240 4:23882562-23882584 ACGGGACATTTGACAATATCTGG - Intronic
971144288 4:23960228-23960250 AAGGGACACCTGGCAATATCAGG + Intergenic
971214655 4:24651870-24651892 GTGGGACATTTGGCAATATCTGG + Intergenic
971216460 4:24666390-24666412 AGGGGACATTTGGCAATGTCTGG + Intergenic
971354072 4:25878758-25878780 AGGAGACATTTGGCAATGTCTGG + Intronic
971574796 4:28258621-28258643 ATGATATATCAGGCTATATCAGG + Intergenic
971809303 4:31403170-31403192 AGAAGACATGTGGGAATATCTGG + Intergenic
972435927 4:39035362-39035384 CAGGGACATCTGACAATATCTGG - Intergenic
972732401 4:41807903-41807925 TTGAAACATTTGGCAATGTCTGG + Intergenic
973211477 4:47619885-47619907 AAAAGACATCTGGAAACATCTGG + Intronic
973280224 4:48352616-48352638 AAGGGACACCTGGCAACATCTGG - Intronic
973608989 4:52616145-52616167 AGGAGACATCTGACAATGTCTGG + Intronic
973700581 4:53533380-53533402 AAGAGACATCTGACAATATCTGG + Intronic
973737931 4:53890889-53890911 AGAAGACATTTGGCAATGTCTGG - Intronic
973789901 4:54368174-54368196 AGTGGACATTTGGCAATATCTGG - Intergenic
974118740 4:57612379-57612401 ATGAGACAGTTGGCAATGACTGG + Intergenic
975575786 4:75861129-75861151 AGGGGACATTTGGCAATGTCTGG + Intronic
976333861 4:83863235-83863257 AGGGGACATTTGGCAATGTCTGG - Intergenic
976469516 4:85411663-85411685 AAGAGACGTTTGGCAATATCTGG - Intergenic
976479909 4:85529683-85529705 AGAGGACATTTGGCAATATCTGG - Intronic
976657641 4:87506104-87506126 ATGGAACATTTGGCAATGTCTGG - Intronic
976705110 4:88011926-88011948 AGGGGACATTTGGCAATCTCTGG + Intronic
977196821 4:94073076-94073098 AAGAGGCATGTGGCATTATCTGG - Intergenic
977279350 4:95020157-95020179 AGGGGACATTTGGCAATGTCTGG + Intronic
977593528 4:98852631-98852653 AGGGGACATTTGGCAATGTCTGG - Intergenic
977601662 4:98939872-98939894 AGGAGTCACTTGGCAATATCTGG - Intergenic
977866707 4:102037147-102037169 ATAAGACATTTGTCAATGTCTGG + Intronic
978131578 4:105204420-105204442 ATTAGACATCATGTAATATCAGG + Intronic
978594421 4:110361352-110361374 AGGGGACATTTGGCAATGTCTGG + Intergenic
978608661 4:110511424-110511446 ACGAGACAGCTGGAAATATGTGG - Intronic
979074882 4:116258841-116258863 AGAGGACATCTGGCAATATATGG - Intergenic
979249035 4:118544383-118544405 ATAAGACAGCTGGAAAGATCAGG + Intergenic
979277320 4:118828479-118828501 ATAGGACATCTGGCAATGTTTGG + Intronic
979352520 4:119661511-119661533 TTGAAAGATCTGACAATATCTGG - Intergenic
979764652 4:124449239-124449261 ATGAAATATGTGGCAATATTAGG - Intergenic
979843847 4:125482941-125482963 ATGGGACATTTGGCAATATCTGG + Intronic
980510457 4:133779767-133779789 AGGGAACATCTGGCAATGTCTGG + Intergenic
980857185 4:138454421-138454443 AGGGGACATTTGGCAATATCTGG - Intergenic
981016166 4:139976842-139976864 AGGGCACATCTGGCAATGTCTGG + Intronic
981084705 4:140671191-140671213 AGGAGACATCTGGCAACATCTGG + Intronic
981473298 4:145161606-145161628 AGGAAACATTTGGCAAAATCTGG + Intronic
981495519 4:145387436-145387458 AAGGGACATTTGGCAATGTCTGG - Intergenic
981799143 4:148635800-148635822 AGGGAACATTTGGCAATATCTGG - Intergenic
981822402 4:148901213-148901235 AGAAGACATCTGGCAATGTCTGG - Intergenic
981924864 4:150128070-150128092 AGGAGACATTTGGAAATTTCTGG + Intronic
982028021 4:151271463-151271485 AGGGGACATTTGGCAATGTCTGG + Intronic
982287293 4:153748473-153748495 AGGAGACATTTGGCAATGTCTGG - Intronic
982427049 4:155276572-155276594 ACCAGACATCTGGCAATGTCTGG + Intergenic
983551747 4:169024998-169025020 AGGAGACATTTGGCAATGTCTGG - Intergenic
983944071 4:173566834-173566856 AGGAGACATTTGGCAATGTCAGG + Intergenic
984494918 4:180484527-180484549 AGGAAACAGCTGGCAACATCTGG - Intergenic
985132711 4:186755420-186755442 AGGAGACATTTGAAAATATCTGG - Intergenic
985193116 4:187399451-187399473 AGGGGACATTTGGCAATGTCTGG + Intergenic
985924526 5:3005447-3005469 ATGAGACATCATGCAATAAAGGG + Intergenic
986648144 5:9938599-9938621 AGGAGACATTTGGCAATGTTTGG + Intergenic
986836097 5:11639083-11639105 AGGAGACATTTGACAATATCTGG + Intronic
987169770 5:15241843-15241865 AGGGGACATTTGGTAATATCTGG + Intergenic
987204957 5:15615403-15615425 AGGGGACATTTAGCAATATCTGG - Intronic
987373550 5:17215486-17215508 AGGAGACATTTGGCGATATCTGG + Intronic
987914821 5:24199167-24199189 ATAAGAAATCTGTCAATTTCAGG + Intergenic
988445623 5:31283088-31283110 AGGGGACATTTGGAAATATCTGG + Intronic
988493912 5:31728269-31728291 GGGGGACATTTGGCAATATCTGG - Intronic
988557798 5:32253081-32253103 AGGGGACATTTGGCAATACCTGG + Intronic
989106608 5:37868871-37868893 AGGAGACATCTGGCAAAATCTGG - Intergenic
989109343 5:37892031-37892053 AGGGGACATTTGGCAATGTCCGG + Intergenic
989224892 5:39015482-39015504 AGGGAACATTTGGCAATATCTGG + Intronic
989730199 5:44639877-44639899 ATCACACATCTGGCAAAAGCAGG + Intergenic
989735300 5:44696188-44696210 AAGGTACATCTGGCAATGTCTGG - Intergenic
990206603 5:53436248-53436270 AGGGGACATTTGGCAATGTCTGG + Intergenic
990744732 5:58948303-58948325 AGGAGAAATCTGGAAATGTCTGG - Intergenic
991593228 5:68276350-68276372 ATGAGCCATCTGGCAATGTCTGG - Intronic
992108003 5:73466243-73466265 ATGAGACATCAGCCAATACATGG + Intergenic
992232914 5:74681233-74681255 AGGTGATATTTGGCAATATCTGG + Intronic
992360113 5:76028855-76028877 AGGAGACATTTGGCAATTTCTGG - Intergenic
992515680 5:77490389-77490411 AGGAGACATTTGGCAATGTCTGG - Intronic
992695742 5:79285166-79285188 AGGAGACAACTGGCAAAATGAGG - Intronic
993542786 5:89173036-89173058 AGGGGACATATGGCAATGTCTGG + Intergenic
993543374 5:89180397-89180419 AGGAGACATATGGCAATGTCTGG + Intergenic
994110145 5:95993410-95993432 AAGGGACATTTGGCAATGTCTGG + Intergenic
994206123 5:97037814-97037836 AGGGGACATTTGGCAATGTCTGG - Intergenic
994296886 5:98100942-98100964 AGGAGACATTTGACAATGTCTGG - Intergenic
994648197 5:102496021-102496043 TTGAGACAGCTGGCAACATCTGG + Intronic
994672651 5:102781007-102781029 AGGAGACATTTGGCAACATCTGG - Intronic
994678674 5:102858330-102858352 AGAAGACATTTGGCAATGTCTGG + Intronic
995139532 5:108719824-108719846 AGGGGACATTTGGCAATGTCTGG + Intergenic
995139957 5:108724847-108724869 AGGAGACATTTGGCAACGTCTGG + Intergenic
995837983 5:116416891-116416913 ATGGGACAATTGGCAATGTCTGG + Intergenic
995956758 5:117785841-117785863 AGGGGACTTCTGGCAATGTCTGG - Intergenic
995995952 5:118299666-118299688 AAGAGACACCTGGCAATTTTAGG + Intergenic
998313845 5:141161090-141161112 ATCAAACATTTGGCAATGTCTGG + Intergenic
998394986 5:141812496-141812518 AAGGGACATTTGGCAATGTCTGG - Intergenic
998680741 5:144464399-144464421 AGGGGACAGCTGGCAATATCTGG + Intronic
999112283 5:149132123-149132145 TGGGGACATTTGGCAATATCTGG + Intergenic
999137728 5:149333795-149333817 GAGGGACATCTGGCAATTTCTGG - Intronic
999464950 5:151794043-151794065 ATGAGACATCTGGCAATATCTGG - Intronic
999621371 5:153478017-153478039 AGGAGACATTTGGCAATGTCTGG - Intergenic
999656712 5:153817708-153817730 AGGAGACATTTAGCAATATCTGG + Intergenic
999821447 5:155232990-155233012 CAGAGACATTTGGCAATGTCTGG + Intergenic
999890655 5:155975331-155975353 AGGAGACATTTGGCAGTATCTGG + Intronic
1000128530 5:158271814-158271836 AGGAGACATTTGGTAATGTCTGG + Intergenic
1000161308 5:158600314-158600336 AGGAGACATTTGGCAATGTCTGG - Intergenic
1000329814 5:160197699-160197721 CTGGGACATTTGGCAATATCTGG - Intronic
1000336709 5:160246727-160246749 AGGGGACATTTGGCAATGTCTGG - Intergenic
1000475144 5:161697574-161697596 AAGAGACATTGGGCAATGTCTGG + Intronic
1000663830 5:163970162-163970184 CAGTGACATCTGGCAGTATCTGG - Intergenic
1000862972 5:166478599-166478621 GGGAGACAGTTGGCAATATCTGG - Intergenic
1000865616 5:166511425-166511447 AAGGGACATTTGGCAATATCTGG + Intergenic
1001075527 5:168624794-168624816 AGGAGACATTTGGCAGTATCTGG + Intergenic
1001157082 5:169281883-169281905 AGGGGACATTTGGCAATGTCTGG + Intronic
1001441916 5:171750008-171750030 AGGAGACATTTGGCAATGTCTGG + Intergenic
1001706631 5:173745799-173745821 ACGGGACATTTGGCAATGTCTGG - Intergenic
1002049135 5:176559809-176559831 AGGAGACACCTGGCAATGTCTGG + Intronic
1002712062 5:181201295-181201317 AGGGGACATCTGGCAAAGTCTGG - Intronic
1002877922 6:1227457-1227479 CAGGGACATTTGGCAATATCTGG - Intergenic
1003034114 6:2628260-2628282 AGGGGACATCTGGCAATGTCTGG + Intronic
1003295128 6:4819729-4819751 AAGGGACATTTGGCAATGTCTGG + Intronic
1003444165 6:6169621-6169643 AGGGGACATTTGGCAATGTCTGG + Intronic
1003896450 6:10612345-10612367 AGGGGACATTTGGCAATGTCTGG + Intronic
1003917123 6:10797366-10797388 GGGAGATATCTGGCAATGTCTGG + Intronic
1004039680 6:11963088-11963110 AGGTGACATTTGGCAATGTCTGG + Intergenic
1004129090 6:12901950-12901972 AGGGGACATTTGGCAATGTCTGG + Intronic
1004129328 6:12903897-12903919 ATAAAACATATGGCATTATCAGG - Intronic
1004323738 6:14654491-14654513 AGGAGACATCTGGCAATGTCTGG + Intergenic
1004367217 6:15022380-15022402 AGGGGACATTTGGCAATGTCTGG + Intergenic
1004429151 6:15528415-15528437 AGGGGACATTTGGCAATGTCTGG - Intronic
1004699155 6:18062650-18062672 AGGGAACATTTGGCAATATCTGG + Intergenic
1004927415 6:20428986-20429008 ATGTGACCTTTGGCAATGTCTGG + Intronic
1005108641 6:22253186-22253208 ATGGGACATTTGGCACTTTCTGG - Intergenic
1005354381 6:24968539-24968561 AGGGGACATCTGGCAATGTCTGG + Intronic
1005815377 6:29547616-29547638 CTGGGACATTTGGCAATGTCTGG + Intergenic
1006381264 6:33698775-33698797 AGGGGACATGTGGCAATGTCTGG - Intronic
1006432345 6:34005293-34005315 AGGAGACATTTGGCAAAGTCTGG + Intergenic
1006548446 6:34799936-34799958 ATTAGACATCTGGAAAAGTCTGG - Intronic
1006755949 6:36415646-36415668 ATGAGACAATTGGCAGTAGCTGG + Intronic
1007164120 6:39816514-39816536 CAGAGACATTTGGCAATGTCTGG - Intronic
1007501879 6:42304739-42304761 AAGAGACAGTTGGCAATGTCTGG - Intronic
1007688072 6:43679167-43679189 AGGGGACATCTGGCAATGTCTGG + Intronic
1008008200 6:46434772-46434794 AGGGGACATCTGGCAATGTCTGG + Intronic
1008034275 6:46729811-46729833 AGGGGACATCTGGCAATGTCTGG - Intronic
1008268974 6:49466961-49466983 AGGAGACATTTGGCAATGTCTGG + Intronic
1008375378 6:50785641-50785663 AGGGGACATTTGGCAATGTCTGG - Intergenic
1008429886 6:51403338-51403360 GTATGACAACTGGCAATATCTGG + Intergenic
1008443890 6:51565359-51565381 AGGGGACATCTGGCAGTGTCTGG - Intergenic
1009037701 6:58137822-58137844 AGTGGACATCTGGCCATATCTGG - Intergenic
1009196620 6:60694513-60694535 ATGGGACCATTGGCAATATCTGG + Intergenic
1009272820 6:61636561-61636583 AGGGGACATTTGGCAATGTCTGG + Intergenic
1010126753 6:72441436-72441458 AGGAGACATTTGACAATGTCTGG - Intergenic
1010405843 6:75504970-75504992 AAGGGACATTTGGCAATATCTGG + Intergenic
1010701677 6:79056542-79056564 AGGAGATATTTGGCAATGTCTGG + Intronic
1010928281 6:81769984-81770006 CTGAGACATCAGGCAATTTGAGG + Intergenic
1011038854 6:83008232-83008254 AGGAGACATTTGGCAATGTCTGG - Intronic
1011058075 6:83228492-83228514 AGGAAACATTTGGCAATGTCTGG - Intronic
1012841159 6:104330718-104330740 AAGGGACATTTGGCAATGTCTGG + Intergenic
1013158538 6:107519199-107519221 AGGGGACATTTGGTAATATCGGG + Intronic
1013158744 6:107521091-107521113 AGGGGACATTTGGTAATATCGGG - Intronic
1013359975 6:109384749-109384771 AGGAGACATTTAACAATATCGGG - Intergenic
1013809522 6:114028607-114028629 ACAAGACATTTGGCAACATCTGG - Intergenic
1014102071 6:117522339-117522361 ATGAGACATTTGGCAATGTCTGG - Intronic
1014260121 6:119206857-119206879 CTGCGACATAAGGCAATATCAGG + Intronic
1014740739 6:125145226-125145248 AGGAGACATGTGGCAATGTAGGG + Intronic
1014780901 6:125563563-125563585 AGGGGACATTTGGCAATATCTGG - Intergenic
1014867413 6:126549837-126549859 AGGAGACATTTGGCAATGTCGGG + Intergenic
1015182796 6:130378904-130378926 ATTAGAGTGCTGGCAATATCAGG + Intronic
1015648806 6:135429746-135429768 AAGGAACATCTGGCAGTATCTGG - Intronic
1015708766 6:136116786-136116808 ATGAGCCATCTGGCCAGAACAGG + Intronic
1015830306 6:137361890-137361912 AGGAAACATTTGGCAATGTCTGG + Intergenic
1016078578 6:139828202-139828224 AGGGGACATTTGGCAATGTCTGG + Intergenic
1016469103 6:144356378-144356400 ACGAGACATCTGGCAATATCTGG - Intronic
1016656526 6:146524614-146524636 AGGAGATATTTGGCAATGTCAGG + Intergenic
1016791105 6:148067825-148067847 AGGGGACATTTGGCAATATCTGG - Intergenic
1017404399 6:154102677-154102699 AGGAGACATTTGGCAATATCTGG - Intronic
1017759279 6:157555829-157555851 AGGGGACATTTGGCAATGTCGGG - Intronic
1018083860 6:160284325-160284347 AGGGGACATTTGGCAATGTCTGG + Intergenic
1018392466 6:163350917-163350939 AGGAGACATGTGGCAATGTATGG + Intergenic
1020929480 7:14374872-14374894 AGGAGACATTCGGCAATATCTGG - Intronic
1021034491 7:15780814-15780836 ATGGTAAATCTGGCAATCTCTGG - Intergenic
1021075599 7:16300551-16300573 AGGGAACATTTGGCAATATCAGG + Intronic
1021216766 7:17925637-17925659 ATGAGACACTTGGCAATGTATGG + Intronic
1021233989 7:18120144-18120166 TTGGGACATTTGGCAATGTCTGG + Intronic
1021273854 7:18625545-18625567 AGGGGACATTTGGCAATATCTGG - Intronic
1021470059 7:20991764-20991786 AGGAGACATTTGGCAAAGTCTGG - Intergenic
1021577919 7:22121314-22121336 ATCAGACATTTGGCTATTTCAGG + Exonic
1021793441 7:24228909-24228931 AGGAGGCATTTGGCAATGTCTGG - Intergenic
1022238985 7:28490723-28490745 AGGGGACATTTGGCAATGTCTGG - Intronic
1022271489 7:28812090-28812112 AGGGGACATTTGGCAATGTCTGG - Intronic
1022386268 7:29901953-29901975 AGGAGACATTTGGCAATGTCTGG + Intronic
1022396956 7:29997617-29997639 AGGGGACATTTGGCAATGTCTGG + Intergenic
1022410025 7:30132305-30132327 AGGGGACATTTGGCAATGTCTGG + Intergenic
1022513760 7:30962361-30962383 AGGGGACATTTGGCAATGTCTGG - Intronic
1022661906 7:32375455-32375477 AGGGGACATTTGGCAATGTCTGG + Intergenic
1022828329 7:34039395-34039417 AGGGGACATTTGGCAATGTCTGG + Intronic
1022830878 7:34065434-34065456 AGGGGACATTTGGCAGTATCTGG - Intronic
1023110002 7:36800474-36800496 AAGAGACAACTGTCAAAATCAGG + Intergenic
1023220854 7:37919191-37919213 AAGAAACATTTGGCAATATCTGG - Intronic
1023503127 7:40871961-40871983 ATGGGAAATTTGGCAATGTCTGG + Intergenic
1023695134 7:42837687-42837709 AGGACACATCTGGCAATATCTGG + Intergenic
1023739873 7:43269803-43269825 AGGAGACAATTGGCAATGTCTGG + Intronic
1023980890 7:45069335-45069357 AGGGGACATGTAGCAATATCTGG - Intronic
1024027502 7:45425235-45425257 AGGAGACATTTGGCAATGTCTGG - Intergenic
1024968090 7:55043264-55043286 GGGAGACATCTGGCAATGTTTGG + Intronic
1025254908 7:57377835-57377857 AGGAGACATGTGGCAATATCTGG - Intergenic
1025964473 7:66255198-66255220 AGGGGACATTTGGCAATGTCTGG + Intronic
1026032930 7:66810411-66810433 AGGAGACATCTGACTATGTCTGG - Exonic
1026348430 7:69494993-69495015 AGGGGACATTTGGCAATGTCGGG - Intergenic
1027772137 7:82419886-82419908 AGGAGACATCTGATGATATCTGG + Intronic
1027876247 7:83773439-83773461 AAGAGACTTCTGGCAGTATCAGG + Intergenic
1028061550 7:86324274-86324296 AAGGGACATATGACAATATCTGG - Intergenic
1028357603 7:89928152-89928174 ATGGGACATTTGGCAATGTCTGG + Intergenic
1028478072 7:91273590-91273612 AGGAGACATTTGGCAATATTGGG + Intergenic
1030296677 7:107935616-107935638 AAGAGACATCTGGAAATACTTGG + Exonic
1030933588 7:115556467-115556489 AGGGGACATTTGACAATATCTGG - Intergenic
1030982214 7:116199739-116199761 AGAAGACATTTGGCAATGTCTGG + Intergenic
1031210236 7:118815566-118815588 AGGGGACATTTGGCAATGTCTGG + Intergenic
1031505693 7:122579223-122579245 AGGAGACATTTAGCAATGTCTGG + Intronic
1032118006 7:129133652-129133674 TAGAGACATTTGGCAATGTCTGG - Intergenic
1032184780 7:129715191-129715213 AGGGGACATTTGGCAATACCTGG + Intronic
1032384894 7:131515119-131515141 AGGAGACATTTGGCAATATCTGG - Intronic
1032572125 7:133011585-133011607 ATGGGACTTCTGGCCATACCTGG - Intronic
1032744941 7:134776918-134776940 AAAAGACATTTGGAAATATCTGG - Intronic
1033367623 7:140683707-140683729 AGGGGACATCTGGCGATGTCTGG + Intronic
1033820614 7:145130300-145130322 ATGGGACATTTGGCAATGTCTGG - Intergenic
1033903467 7:146172238-146172260 AGGAAACATCTGGCAATATTTGG + Intronic
1034059756 7:148076228-148076250 AGGAGACATTTGGCAATGACTGG + Intronic
1034332389 7:150294183-150294205 AGGGAACATCTGACAATATCTGG + Intronic
1034484861 7:151353381-151353403 AGGAGACATTTGGCATTGTCTGG + Intronic
1034665648 7:152815695-152815717 AGGGAACATCTGACAATATCTGG - Intronic
1035149146 7:156852674-156852696 AGGAGACATGTTGCAATGTCTGG + Intronic
1035899555 8:3444511-3444533 TTGGGACATTTGGCAATGTCTGG + Intronic
1036048166 8:5166926-5166948 ATTAGAGATCTGGAAACATCTGG - Intergenic
1037496724 8:19447638-19447660 CTGGGACATCTGGCAAGGTCTGG - Intronic
1037536160 8:19826730-19826752 AGGGGACATTTGGCAATGTCTGG + Intronic
1039249216 8:35643239-35643261 AGGGAACATCTGGCAATGTCTGG - Intronic
1039723896 8:40194493-40194515 AAGGGACATTTGGCAATGTCTGG - Intergenic
1039761560 8:40582308-40582330 CTGAGCCACATGGCAATATCTGG + Intronic
1040033921 8:42850558-42850580 ATGGTACATCTGTGAATATCTGG + Intronic
1040077470 8:43252066-43252088 AAGAGACTTCTGGAAATTTCTGG - Intergenic
1040563977 8:48549577-48549599 AGGAGACATTTAGCAATGTCTGG - Intergenic
1041575784 8:59393266-59393288 ATGAGAGAGTTAGCAATATCAGG - Intergenic
1043412673 8:80014831-80014853 AGGGGACATTTGGCAATGTCTGG + Intronic
1043600166 8:81928156-81928178 ATGAGGCATTTAACAATATCTGG - Intergenic
1043723118 8:83573066-83573088 AAACGACATTTGGCAATATCTGG - Intergenic
1044289243 8:90448177-90448199 AGGGAACATGTGGCAATATCTGG + Intergenic
1044895594 8:96888190-96888212 AAGGGACATTTGGCAATGTCTGG - Intronic
1044902799 8:96966636-96966658 AGGGGACATCTGGCAATGTCTGG - Intronic
1045325657 8:101115934-101115956 AGGGGACATTTGGCAAGATCTGG + Intergenic
1045402793 8:101835363-101835385 AGGAGATATCTGGCAATGCCTGG + Intronic
1045687041 8:104722961-104722983 AGGGGATATTTGGCAATATCTGG - Intronic
1045860878 8:106813930-106813952 AGGGGACATTTGGCAATATTTGG + Intergenic
1046017585 8:108623785-108623807 ATGGGACATTTGGCCATGTCTGG + Intronic
1046105924 8:109666417-109666439 AGGAGATGTCTGGCAATGTCTGG - Intronic
1046227863 8:111308824-111308846 AGGAGATATATGTCAATATCTGG - Intergenic
1046343102 8:112884598-112884620 GGGAGACATTTGGCAATGTCTGG - Intronic
1046409797 8:113826687-113826709 AGGAGACATTTGGCAGTATCTGG - Intergenic
1046653238 8:116863591-116863613 ATGAGACATCTGTCAATGTGGGG - Intronic
1047315293 8:123727507-123727529 AGGAGACAATTGGCAATGTCTGG + Intronic
1047376132 8:124298988-124299010 AGGGGACCTTTGGCAATATCTGG - Intergenic
1047706673 8:127506179-127506201 AGGATACATTTGGCAATGTCTGG - Intergenic
1048257942 8:132919733-132919755 AAGAGACATTTGGCAATGTCTGG - Intronic
1048402745 8:134087188-134087210 AGGGGGCATCTGGCAATGTCTGG + Intergenic
1048582644 8:135742959-135742981 AGGGGACATTTGGCAATGTCTGG - Intergenic
1048790950 8:138102876-138102898 AGGATACATCTGGTAATGTCTGG + Intergenic
1049096748 8:140552905-140552927 AGGGGACATCTGGCAGTGTCTGG - Intronic
1050183295 9:2943325-2943347 AGGGGACATTTGGCAATGTCTGG + Intergenic
1050313979 9:4382207-4382229 ATGACACATCTGGAAAAATCAGG + Intergenic
1050673828 9:8028994-8029016 AGGAGACATCTGGCAATGCCTGG - Intergenic
1051214896 9:14786527-14786549 AAGGGACATTTGGCAATGTCTGG + Intronic
1052668300 9:31522445-31522467 AGGAAACATATTGCAATATCAGG + Intergenic
1053492164 9:38516440-38516462 GTGAAACATCAGGCAAAATCAGG + Intergenic
1053537034 9:38936346-38936368 AGGGGACATTTGGCAATGTCTGG - Intergenic
1054629102 9:67427584-67427606 AGGGGACATTTGGCAATGTCTGG + Intergenic
1054890858 9:70250302-70250324 AAGGGACATTTGGAAATATCTGG + Intergenic
1055119032 9:72636816-72636838 AGGGGACATTTGGCAATGTCTGG + Intronic
1055460975 9:76519925-76519947 AAGAGACATCTCACAATGTCTGG - Intergenic
1055536397 9:77250400-77250422 AAGAGACATTTGTCAATATCTGG + Intronic
1055561978 9:77530254-77530276 ATGAGAGTTCTTGCAAGATCTGG + Intronic
1055648403 9:78382644-78382666 AAGGGACATTTGGCAATGTCTGG + Intergenic
1055650470 9:78402097-78402119 GGGAGACATTTGGCAATGTCTGG + Intergenic
1055705376 9:78994795-78994817 TTCAGACATTTGGGAATATCGGG - Intergenic
1057261934 9:93589485-93589507 AGGAGACAGTTGGCAATTTCTGG - Intronic
1058820614 9:108725877-108725899 AGGGGACATTTGGCAATGTCTGG + Intergenic
1058924260 9:109646193-109646215 ATGAAACATCAGGCAATGGCAGG + Intronic
1059315014 9:113416847-113416869 AGGGGACATCTGGTAATGTCTGG - Intronic
1059440484 9:114304110-114304132 AGGGGATATTTGGCAATATCTGG - Intronic
1059482587 9:114603098-114603120 AGGGGACATTTGACAATATCTGG - Intergenic
1059691473 9:116688971-116688993 AGGAGACATTAGGCAATGTCTGG + Intronic
1059945330 9:119403734-119403756 AAGGGACATTTGGCAATATCTGG - Intergenic
1059949624 9:119448736-119448758 TGGAGACATTTGGCAATGTCCGG + Intergenic
1060603566 9:124894745-124894767 ACAAGACATTTGGCAATGTCTGG + Intronic
1060623453 9:125088989-125089011 AAGACACATTTGGCAATATCTGG - Intronic
1060806580 9:126581418-126581440 AAGGCACATCTGGCAATGTCTGG + Intergenic
1062148401 9:135004137-135004159 AGGAGACATTTGGCAATATCTGG + Intergenic
1185552770 X:997380-997402 AGGAGATATTTTGCAATATCTGG + Intergenic
1185969541 X:4647260-4647282 AGGAAACATTTGGCAATGTCTGG + Intergenic
1186071514 X:5826198-5826220 AGTGGACATGTGGCAATATCTGG + Intergenic
1186201790 X:7162674-7162696 AGGAGACATTTGGCAACATCTGG - Intergenic
1186201877 X:7163267-7163289 AAGAAACATCTGGTGATATCTGG - Intergenic
1186210413 X:7244607-7244629 AGAGGACATTTGGCAATATCTGG + Intronic
1186239597 X:7552318-7552340 AGGAAACATTTGGCCATATCTGG + Intergenic
1186250834 X:7664475-7664497 AGGAGATATTTGGCAATGTCTGG + Intergenic
1186290238 X:8089316-8089338 TAGAGATATTTGGCAATATCTGG + Intergenic
1186411646 X:9349218-9349240 AGGGGACATTTGGCAATGTCTGG - Intergenic
1186444796 X:9618033-9618055 CTGGGACATCTGGCAATATCTGG - Intronic
1186476281 X:9860077-9860099 AGGAGACATGTGGTAACATCTGG + Intronic
1186514963 X:10160132-10160154 AGGGGACATTTGGCAATGTCTGG - Intronic
1186523757 X:10228899-10228921 AGGAGACATTTGGCATTGTCTGG + Intronic
1186526516 X:10254103-10254125 GGGGGACATTTGGCAATATCTGG + Intergenic
1186561935 X:10621989-10622011 AGGAGACATTTGGTAATGTCTGG - Intronic
1186595085 X:10972510-10972532 AGGAGACTTCTGGCAATTTCTGG - Intergenic
1186608224 X:11112800-11112822 AGGGGACATTTGCCAATATCTGG + Intronic
1186622201 X:11253222-11253244 TGGGGACATCTGGCAATGTCTGG - Intronic
1186628142 X:11317357-11317379 AGGAGACATCTGGCAAAGTCGGG - Intronic
1186635651 X:11401568-11401590 AAGGGACATTTGGCAATGTCTGG - Intronic
1186656452 X:11616747-11616769 AGGGGACATTTGGCAATATTTGG + Intronic
1186711642 X:12204119-12204141 AGGAGACATCTTGTAATGTCTGG + Intronic
1186732543 X:12425582-12425604 TTGAGACACTTGGCAATGTCTGG + Intronic
1186796140 X:13048181-13048203 AGGAGACAGTTGGCAATGTCTGG + Intergenic
1186829493 X:13376534-13376556 AGGGGACATCTGGCAATATCTGG - Intergenic
1186842118 X:13494761-13494783 AGGGGATATTTGGCAATATCTGG + Intergenic
1186851823 X:13587916-13587938 AGGGGACATTTGGCAATGTCTGG + Intronic
1186862931 X:13690978-13691000 AGGAGACATTTGGCAATGCCTGG + Intronic
1186867361 X:13734124-13734146 AGAGGACATCTGGCAATATCTGG + Exonic
1186873158 X:13792178-13792200 AGGGGACATTTGGCAATATCTGG + Intronic
1186978849 X:14937659-14937681 AGAAGACATTTGGCAATGTCTGG + Intergenic
1186999340 X:15159101-15159123 AGGGGACATTTGGCAATGTCTGG + Intergenic
1187005247 X:15226463-15226485 AGGGGACATTTGACAATATCTGG - Intergenic
1187015044 X:15318300-15318322 AGGGGACATCTGGCAATGTCTGG - Intergenic
1187045512 X:15644695-15644717 AGGAGACATTTGGCAATATCTGG - Intronic
1187149007 X:16664749-16664771 AAGAGATATTTGACAATATCTGG + Intronic
1187182675 X:16957923-16957945 AGGAGACATCTGACAATGTCTGG - Intronic
1187185678 X:16982968-16982990 CTGAGATATCTGGCAATGTCTGG + Intronic
1187242707 X:17528121-17528143 AGGGGACATGTGGCAATGTCTGG + Intronic
1187299479 X:18033800-18033822 AGGGGACATTTGGCAATGTCTGG - Intergenic
1187399479 X:18946982-18947004 AGGAGACATTTGGCGATGTCTGG - Intronic
1187441187 X:19321822-19321844 ATGAGACATATGGAACTGTCTGG - Intergenic
1187470441 X:19564948-19564970 AGGGGACATTTGGCAATGTCTGG - Intronic
1187583228 X:20631637-20631659 CAGAGACATTTGGCAACATCTGG + Intergenic
1187698977 X:21946642-21946664 GGGTGACATCTGGCAATTTCTGG + Intronic
1187721372 X:22154473-22154495 TGGAGACATTTGGCAATGTCTGG + Intronic
1187737210 X:22317107-22317129 AGAAGACATTTGGCAATGTCTGG - Intergenic
1187796447 X:23008549-23008571 AAGGGACATTTGGCAATGTCTGG + Intergenic
1187826834 X:23339981-23340003 AGGGGACATCTGGCAATGGCTGG + Intronic
1187885610 X:23886129-23886151 AGGAGACATTTGGCAGTGTCTGG - Intronic
1188195772 X:27231106-27231128 ATGGAACATTTGGCAATGTCTGG + Intergenic
1188251015 X:27894324-27894346 AGGAGATATTTGGCAATGTCTGG - Intergenic
1188338000 X:28961805-28961827 AGGAGACAACTGGCAATATATGG - Intronic
1188415375 X:29926789-29926811 TGGGGACATCTGGCAATGTCTGG - Intronic
1188586446 X:31781832-31781854 AGGAGACATTTGGTAATGTCAGG - Intronic
1189876463 X:45441396-45441418 AGGGGACATTTGACAATATCTGG - Intergenic
1190031240 X:46975029-46975051 AGGGGACATTTGGCAATATCTGG - Intronic
1190060353 X:47207025-47207047 TGGGGACATCTGGCAATGTCTGG - Intronic
1190443715 X:50501946-50501968 AGGAGACATTTGGCAATGTCTGG - Intergenic
1191100917 X:56727596-56727618 AGGGGACATCTGGCAATGTTTGG + Intergenic
1192149914 X:68705822-68705844 AGGGGACATTTGGCAATGTCTGG - Intronic
1192218841 X:69183029-69183051 AGGAGACATTTGACAATGTCTGG - Intergenic
1192347852 X:70326372-70326394 AGGGGACATTTGGCAATATCTGG - Intronic
1192732146 X:73811109-73811131 ATGGGACATCTAGAAATGTCTGG - Intergenic
1193115515 X:77771798-77771820 AGGGAACATCTGGCAATTTCTGG + Intronic
1193335318 X:80281132-80281154 AAGGAACATCTGGAAATATCTGG + Intergenic
1193586875 X:83333445-83333467 AGGTGACATTTGGCAATGTCTGG - Intergenic
1193707722 X:84843395-84843417 AGGAGACATTTGGCAATGTCTGG + Intergenic
1193711788 X:84889495-84889517 AGGAGACATTTGGCAATGTCTGG - Intergenic
1193839575 X:86392900-86392922 ATGGGACATTTGGCAATGTTTGG + Intronic
1195221820 X:102751675-102751697 ATTAGACATTTGGCTACATCTGG + Exonic
1195373120 X:104199743-104199765 GTGAGAAATCTGGAAATTTCTGG + Intergenic
1195380360 X:104264827-104264849 AGGGAACATTTGGCAATATCTGG + Intergenic
1195448387 X:104979805-104979827 AAGGGACATTTGGCAATGTCTGG + Intronic
1195589645 X:106610177-106610199 AGGGGACATTTGGCAATGTCTGG + Intergenic
1195996604 X:110737893-110737915 AGGGGACATTTGGCAATGTCTGG + Intronic
1196175598 X:112636159-112636181 GGGGGACATCTGGCAATGTCTGG - Intronic
1196677974 X:118440363-118440385 AGGGGACATCTAGCATTATCTGG - Intronic
1196731496 X:118945428-118945450 AGAGGACATTTGGCAATATCTGG + Intergenic
1196908977 X:120467421-120467443 AGGGGACATTTGGCAACATCTGG - Intronic
1197175060 X:123476887-123476909 AGGGGACATTTGGCAATGTCTGG - Intronic
1197199594 X:123736431-123736453 AGGAGACATTTAGCAATGTCTGG - Intergenic
1197837421 X:130710427-130710449 AGGGGACATTTGGCAGTATCTGG + Intronic
1198064597 X:133084032-133084054 TTGAGAAATCTGGCAGTATGAGG + Intronic
1198649218 X:138842662-138842684 ATGGGATATTTGGCAATATTTGG + Intronic
1198675102 X:139123028-139123050 CTGGAACATTTGGCAATATCTGG - Intronic
1198953649 X:142102187-142102209 AGGATATATTTGGCAATATCTGG + Intergenic
1199049782 X:143223473-143223495 AGCAGACATTTGGCAGTATCTGG + Intergenic
1199799525 X:151235863-151235885 AGGGGATATCTGGCAATGTCTGG - Intergenic
1200183554 X:154166886-154166908 AAGGGACATTTGGCAATCTCTGG + Intergenic
1200189208 X:154204014-154204036 AAGGGACATTTGGCAATCTCTGG + Intergenic
1200194963 X:154241823-154241845 AAGGGACATTTGGCAATCTCTGG + Intergenic
1200200613 X:154278944-154278966 AAGGGACATTTGGCAATCTCTGG + Intronic
1200307614 X:155044149-155044171 AAGAGACATCTGGCAGGATTTGG + Intronic
1200754491 Y:6977468-6977490 AAGAGACATTTGACAATGTCTGG - Intronic
1201788244 Y:17808649-17808671 AGAGGACATCTGGCAATGTCTGG + Intergenic
1201813309 Y:18097339-18097361 AGAGGACATCTGGCAATGTCTGG - Intergenic
1202375167 Y:24228670-24228692 ATGGGACATTTGGAAATATCTGG - Intergenic
1202495613 Y:25441450-25441472 ATGGGACATTTGGAAATATCTGG + Intergenic